PPP6C-protein phosphatase 6, catalytic subunit Gene View larger

PPP6C-protein phosphatase 6, catalytic subunit Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP6C-protein phosphatase 6, catalytic subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP6C-protein phosphatase 6, catalytic subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006990
Product type: DNA & cDNA
Ncbi symbol: PPP6C
Origin species: Human
Product name: PPP6C-protein phosphatase 6, catalytic subunit Gene
Size: 2ug
Accessions: BC006990
Gene id: 5537
Gene description: protein phosphatase 6, catalytic subunit
Synonyms: PP6; PP6C; serine/threonine-protein phosphatase 6 catalytic subunit; serine/threonine protein phosphatase catalytic subunit; protein phosphatase 6 catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccgctagacctggacaagtatgtggaaatagcgcggctgtgcaagtacctgccagagaacgacctgaagcggctatgtgactacgtttgtgacctcctcttagaagagtcaaatgttcagccagtatcaacaccagtaacagtgtgtggagatatccatggacagttttatgacctttgtgaactgttcagaactggaggtcaggttcctgacacaaactacatatttatgggtgattttgtagacagaggttactatagtttggagaccttcacttaccttcttgcattaaaggctaaatggcctgatcgtattacacttttgcgaggaaatcatgagagtagacagataacacaggtctatggattttatgatgagtgccaaaccaaatatggaaatgctaatgcctggagatactgtaccaaagtttttgacatgctcacagtagcagctttaatagatgagcagattttgtgtgtccatggtggtttatctcctgatatcaaaacactggatcaaattcgaaccatcgaacggaatcaggaaattcctcataaaggagcattttgtgatctggtttggtcagatcctgaagatgtggatacctgggctatcagtccccgaggagcaggttggctttttggagcaaaggtcacaaatgagtttgttcatatcaacaacttaaaactcatctgcagagcacatcaactagtgcacgaaggctataaatttatgtttgatgagaagctggtgacagtatggtctgctcctaattactgctatcgttgtggaaatattgcttcgatcatggtcttcaaagatgtaaatacaagagaaccaaagttattccgggcagttccagattcagaacgtgttattcctcccagaacgacaacgccatatttcctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - axin interactor, dorsalization associated
- pyridoxal (pyridoxine, vitamin B6) kinase
- cytokine induced apoptosis inhibitor 1
- potassium channel, subfamily K, member 6

Buy PPP6C-protein phosphatase 6, catalytic subunit Gene now

Add to cart