PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene View larger

PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene

PTXBC000123

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000123
Product type: DNA & cDNA
Ncbi symbol: PDXK
Origin species: Human
Product name: PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene
Size: 2ug
Accessions: BC000123
Gene id: 8566
Gene description: pyridoxal (pyridoxine, vitamin B6) kinase
Synonyms: C21orf124; C21orf97; HEL-S-1a; PKH; PNK; PRED79; epididymis secretory sperm binding protein Li 1a; pyridoxamine kinase; pyridoxine kinase; vitamin B6 kinase; pyridoxal (pyridoxine, vitamin B6) kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattcagatgagctccaggagttgtacgaaggcctgaggctgaacaacatgaataaatatgactacgtgctcacaggttatacgagggacaagtcgttcctggccatggtggtggacattgtgcaggagctgaagcagcagaaccccaggctggtgtacgtgtgtgatccagtcttgggtgacaagtgggacggcgaaggctcgatgtacgtcccggaggacctccttcccgtctacaaagaaaaagtggtgccgcttgcagacattatcacgcccaaccagtttgaggccgagttactgagtggccggaagatccacagccaggaggaagccttgcgggtgatggacatgctgcactctatgggccccgacaccgtggtcatcaccagctccgacctgccctccccgcagggcagcaactacctgattgtgctggggagtcagaggaggaggaatcccgctggctccgtggtgatggaacgcatccggatggacattcgcaaagtggacgccgtctttgtgggcactggggacctgtttgctgccatgctcctggcgtggacacacaagcaccccaataacctcaaggtggcctgtgagaagaccgtgtctaccttgcaccacgttctgcagaggaccatccagtgtgcaaaagcccaggccggggaaggagtgaggcccagccccatgcagctggagctgcggatggtgcagagcaaaagggacatcgaggacccagagatcgtcgtccaggccacggtgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytokine induced apoptosis inhibitor 1
- potassium channel, subfamily K, member 6
- lectin, galactoside-binding, soluble, 8
- ubiquitin carboxyl-terminal hydrolase L5

Buy PDXK-pyridoxal (pyridoxine, vitamin B6) kinase Gene now

Add to cart