Login to display prices
Login to display prices
KCNK6-potassium channel, subfamily K, member 6 Gene View larger

KCNK6-potassium channel, subfamily K, member 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNK6-potassium channel, subfamily K, member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNK6-potassium channel, subfamily K, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004367
Product type: DNA & cDNA
Ncbi symbol: KCNK6
Origin species: Human
Product name: KCNK6-potassium channel, subfamily K, member 6 Gene
Size: 2ug
Accessions: BC004367
Gene id: 9424
Gene description: potassium channel, subfamily K, member 6
Synonyms: K2p6.1; KCNK8; TOSS; TWIK-2; TWIK2; potassium channel subfamily K member 6; K2P6.1 potassium channel; TWIK-originated similarity sequence; TWIK-originated sodium similarity sequence; inward rectifying potassium channel protein TWIK-2; potassium channel, two pore domain subfamily K, member 6; potassium two pore domain channel subfamily K member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggaggggcgcgcttctggcgggcgccttggccgcgtacgccgcgtacctggtgctgggcgcgctgttggtggcgcggctggaggggccgcacgaagccaggctccgagccgagctggagacgctgcgggcgcagctgcttcagcgcagcccgtgtgtggctgcccccgccctggacgccttcgtggagcgagtgctggcggccggacggctggggcgggtcgtgcttgctaacgcttcggggtccgccaacgcctcggaccccgcctgggacttcgcctctgctctcttcttcgccagcacgctgatcaccaccgtgggctatgggtacacaacgccactgactgatgcgggcaaggccttctccatcgcctttgcgctcctgggcgtgccgaccaccatgctgctgctgaccgcctcagcccagcgcctgtcactgctgctgactcacgtgcccctgtcttggctgagcatgcgttggggctgggacccccggcgggcggcctgctggcacttggtggccctgttgggggtcgtagtgaccgtctgctttctggtgccggctgtgatctttgcccacctcgaggaggcctggagcttcttggatgccttctacttctgctttatctctctgtccaccatcggcctgggcgactacgtgcccggggaggcccctggccagccctaccgggccctctacaaggtgctggtcacagtctacctcttcctgggcctggtggccatggtgctggtgctgcagaccttccgccacgtgtccgacctccacggcctcacggagctcatcctgctgccccctccgtgccctgccagtttcaatgcggatgaggacgatcgggtggacatcctgggcccccagccggagtcgcaccagcaactctctgccagctcccacaccgactacgcttccatccccaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lectin, galactoside-binding, soluble, 8
- ubiquitin carboxyl-terminal hydrolase L5
- enoyl Coenzyme A hydratase 1, peroxisomal
- 3-hydroxyisobutyryl-Coenzyme A hydrolase