ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene View larger

ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene

PTXBC017408

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017408
Product type: DNA & cDNA
Ncbi symbol: ECH1
Origin species: Human
Product name: ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene
Size: 2ug
Accessions: BC017408
Gene id: 1891
Gene description: enoyl Coenzyme A hydratase 1, peroxisomal
Synonyms: HPXEL; delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial; delta3,5-delta2,4-dienoyl-CoA isomerase; delta3,5-delta2,4-dienoyl-coenzyme A isomerase; dienoyl-CoA isomerase; enoyl Coenzyme A hydratase 1, peroxisomal; enoyl-CoA hydratase 1, peroxisomal; peroxisomal enoyl-CoA hydratase 1; enoyl-CoA hydratase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggggatagtggcttctcgcagactccgcgacctactgacccggcgactgacaggctccaactacccgggactcagtattagccttcgcctcactggctcctctgcacaagaggcggcttccggagtagccctcggtgaagccccagaccacagctatgagtcccttcgtgtgacgtctgcgcagaaacatgttctgcatgtccagctcaaccggcccaacaagaggaatgccatgaacaaggtcttctggagagagatggtagagtgcttcaacaagatttcgagagacgctgactgtcgggcggtggtgatctctggtgcaggaaaaatgttcactgcaggtattgacctgatggacatggcttcggacatcctgcagcccaaaggagatgatgtggcccggatcagctggtacctccgtgacatcatcactcgataccaggagaccttcaacgtcatcgagaggtgccccaagcccgtgattgctgccgtccatgggggctgcattggcggaggtgtggaccttgtcaccgcctgtgacatccggtactgtgcccaggatgctttcttccaggtgaaggaggtggacgtgggtttggctgccgatgtaggaacactgcagcgcctgcccaaggtcatcgggaaccagagcctggtcaacgagctggccttcaccgcccgcaagatgatggctgacgaggccctgggcagtgggctggtcagccgggtgttcccagacaaagaggtcatgctggatgctgccttagcgctggcggccgagatttccagcaagagccccgtggcggtgcagagcaccaaggtcaacctgctgtattcccgcgaccattcggtggccgagagcctcaactacgtggcgtcctggaacatgagcatgctgcagacccaagacctcgtgaagtcggtccaggccacgactgagaacaaggaactgaaaaccgtcaccttctccaagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3-hydroxyisobutyryl-Coenzyme A hydrolase
- potassium channel, subfamily K, member 1
- galactose mutarotase (aldose 1-epimerase)
- armadillo repeat containing, X-linked 4

Buy ECH1-enoyl Coenzyme A hydratase 1, peroxisomal Gene now

Add to cart