Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of KCNK1-potassium channel, subfamily K, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNK1-potassium channel, subfamily K, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018051 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNK1 |
| Origin species: | Human |
| Product name: | KCNK1-potassium channel, subfamily K, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC018051 |
| Gene id: | 3775 |
| Gene description: | potassium channel, subfamily K, member 1 |
| Synonyms: | DPK; HOHO; K2P1; K2p1.1; KCNO1; TWIK-1; TWIK1; potassium channel subfamily K member 1; inward rectifying potassium channel protein TWIK-1; potassium channel K2P1; potassium channel KCNO1; potassium channel, two pore domain subfamily K, member 1; potassium inwardly-rectifying channel, subfamily K, member 1; tandem of P domains in a weak inward rectifying K+ channel 1; potassium two pore domain channel subfamily K member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcagtccctggccggcagctcgtgcgtgcgcctggtggagcggcaccgctcggcctggtgcttcggcttcctggtgctgggctacttgctctacctggtcttcggcgcagtggtcttctcctcggtggagctgccctatgaggacctgctgcgccaggagctgcgcaagctgaagcgacgcttcttggaggagcacgagtgcctgtctgagcagcagctggagcagttcctgggccgggtgctggaggccagcaactacggcgtgtcggtgctcagcaacgcctcgggcaactggaactgggacttcacctccgcgctcttcttcgccagcaccgtgctctccaccacaggttatggccacaccgtgcccttgtcagatggaggtaaggccttctgcatcatctactccgtcattggcattcccttcaccctcctgttcctgacggctgtggtccagcgcatcaccgtgcacgtcacccgcaggccggtcctctacttccacatccgctggggcttctccaagcaggtggtggccatcgtccatgccgtgctccttgggtttgtcactgtgtcctgcttcttcttcatcccggccgctgtcttctcagtcctggaggatgactggaacttcctggaatccttttatttttgttttatttccctgagcaccattggcctgggggattatgtgcctggggaaggctacaatcaaaaattcagagagctctataagattgggatcacgtgttacctgctacttggccttattgccatgttggtagttctggaaaccttctgtgaactccatgagctgaaaaaattcagaaaaatgttctatgtgaagaaggacaaggacgaggatcaggtgcacatcatagagcatgaccaactgtcattctcctcgatcacagaccaggcagctggcatgaaagaggaccagaagcaaaatgagccttttgtggccacccagtcatctgcctgcgtggatggccctgcaaaccattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - galactose mutarotase (aldose 1-epimerase) - armadillo repeat containing, X-linked 4 - hexamethylene bis-acetamide inducible 1 - armadillo repeat containing, X-linked 3 |