KCNK1-potassium channel, subfamily K, member 1 Gene View larger

KCNK1-potassium channel, subfamily K, member 1 Gene

PTXBC018051

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNK1-potassium channel, subfamily K, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNK1-potassium channel, subfamily K, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018051
Product type: DNA & cDNA
Ncbi symbol: KCNK1
Origin species: Human
Product name: KCNK1-potassium channel, subfamily K, member 1 Gene
Size: 2ug
Accessions: BC018051
Gene id: 3775
Gene description: potassium channel, subfamily K, member 1
Synonyms: DPK; HOHO; K2P1; K2p1.1; KCNO1; TWIK-1; TWIK1; potassium channel subfamily K member 1; inward rectifying potassium channel protein TWIK-1; potassium channel K2P1; potassium channel KCNO1; potassium channel, two pore domain subfamily K, member 1; potassium inwardly-rectifying channel, subfamily K, member 1; tandem of P domains in a weak inward rectifying K+ channel 1; potassium two pore domain channel subfamily K member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcagtccctggccggcagctcgtgcgtgcgcctggtggagcggcaccgctcggcctggtgcttcggcttcctggtgctgggctacttgctctacctggtcttcggcgcagtggtcttctcctcggtggagctgccctatgaggacctgctgcgccaggagctgcgcaagctgaagcgacgcttcttggaggagcacgagtgcctgtctgagcagcagctggagcagttcctgggccgggtgctggaggccagcaactacggcgtgtcggtgctcagcaacgcctcgggcaactggaactgggacttcacctccgcgctcttcttcgccagcaccgtgctctccaccacaggttatggccacaccgtgcccttgtcagatggaggtaaggccttctgcatcatctactccgtcattggcattcccttcaccctcctgttcctgacggctgtggtccagcgcatcaccgtgcacgtcacccgcaggccggtcctctacttccacatccgctggggcttctccaagcaggtggtggccatcgtccatgccgtgctccttgggtttgtcactgtgtcctgcttcttcttcatcccggccgctgtcttctcagtcctggaggatgactggaacttcctggaatccttttatttttgttttatttccctgagcaccattggcctgggggattatgtgcctggggaaggctacaatcaaaaattcagagagctctataagattgggatcacgtgttacctgctacttggccttattgccatgttggtagttctggaaaccttctgtgaactccatgagctgaaaaaattcagaaaaatgttctatgtgaagaaggacaaggacgaggatcaggtgcacatcatagagcatgaccaactgtcattctcctcgatcacagaccaggcagctggcatgaaagaggaccagaagcaaaatgagccttttgtggccacccagtcatctgcctgcgtggatggccctgcaaaccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - galactose mutarotase (aldose 1-epimerase)
- armadillo repeat containing, X-linked 4
- hexamethylene bis-acetamide inducible 1
- armadillo repeat containing, X-linked 3

Buy KCNK1-potassium channel, subfamily K, member 1 Gene now

Add to cart