Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HEXIM1-hexamethylene bis-acetamide inducible 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HEXIM1-hexamethylene bis-acetamide inducible 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006460 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HEXIM1 |
| Origin species: | Human |
| Product name: | HEXIM1-hexamethylene bis-acetamide inducible 1 Gene |
| Size: | 2ug |
| Accessions: | BC006460 |
| Gene id: | 10614 |
| Gene description: | hexamethylene bis-acetamide inducible 1 |
| Synonyms: | protein HEXIM1; CLP1; EDG1; HIS1; MAQ1; HMBA-inducible; cardiac lineage protein 1; estrogen down-regulated gene 1 protein; hexamethylene bis-acetamide inducible 1; hexamethylene bis-acetamide-inducible protein 1; hexamethylene bisacetamide-inducible protein; hexamethylene-bis-acetamide-inducible transcript 1; hexamthylene bis-acetamide inducible 1; menage a quatre 1; menage a quatre protein 1; hexamethylene bisacetamide inducible 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgagccattcttgtcagaatatcaacaccagcctcaaactagcaactgtacaggtgctgctgctgtccaggaagagctgaaccctgagcgccccccaggcgcggaggagcgggtgcccgaggaggacagtaggtggcaatcgagagcgttcccccagttgggtggccgtccggggccggagggggaagggagcctggaatcccaaccacctcccttgcagacccaggcctgtccagaatctagctgcctgagagagggcgagaagggccagaatggggacgactcgtccgctggcggcgacttcccgccgccggcagaagtggagccgacgcccgaggccgagctgctcgcccagccttgtcatgactccgaggccagtaagttgggggctcctgccgcagggggcgaagaggagtggggacagcagcagagacagctggggaagaaaaaacataggagacgcccgtccaagaagaagcggcattggaaaccgtactacaagctgacctgggaagagaagaaaaagttcgacgagaaacagagccttcgagcttcaaggatccgagccgagatgttcgccaagggccagccggtcgcgccctataacaccacgcagttcctcatggatgatcacgaccaggaggagccggacctcaaaaccggcctgtactccaagcgggccgccgccaaatccgacgacaccagcgatgacgacttcatggaagaagggggtgaggaggatgggggcagcgatgggatgggaggggacggcagcgagtttctgcagcgggacttctcggagacgtacgagcggtaccacacggagagcctgcagaacatgagcaagcaggagctcatcaaggagtacctggaactggagaagtgcctctcgcgcatggaggacgagaacaaccggctgcggctggagagcaagcggctgggtggcgacgacgcgcgtgtgcgggagctggagctggagctggaccggctgcgcgccgagaacctccagctgctgaccgagaacgaactgcaccggcagcaggagcgagcgccgctttccaagtttggagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - armadillo repeat containing, X-linked 3 - methionine adenosyltransferase II, alpha - C-type lectin domain family 4, member M - zinc finger, CCHC domain containing 12 |