Login to display prices
Login to display prices
CLEC4M-C-type lectin domain family 4, member M Gene View larger

CLEC4M-C-type lectin domain family 4, member M Gene

PTXBC038851

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC4M-C-type lectin domain family 4, member M Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC4M-C-type lectin domain family 4, member M Gene

Proteogenix catalog: PTXBC038851
Ncbi symbol: CLEC4M
Product name: CLEC4M-C-type lectin domain family 4, member M Gene
Size: 2ug
Accessions: BC038851
Gene id: 10332
Gene description: C-type lectin domain family 4, member M
Synonyms: CD209L; CD299; DC-SIGN2; DC-SIGNR; DCSIGNR; HP10347; L-SIGN; LSIGN; C-type lectin domain family 4 member M; CD209 antigen-like protein 1; CD299 antigen; DC-SIGN-related protein; dendritic cell-specific ICAM-3-grabbing non-integrin 2; liver/lymph node-specific ICAM-3 grabbing non-integrin; mannose binding C-type lectin DC-SIGNR
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgactccaaggaaccaagggtgcagcagctgggcctcctggaagaagatccaacaaccagtggcatcagactttttccaagagactttcaattccagcagatacatggccacaagagctctacagggtgtcttggccatggcgccctggtgctgcaactcctctccttcatgctcttggctggggtcctggtggccatccttgtccaagtgtccaaggtccccagctccctaagtcaggaacaatccgagcaagacgcaatctaccagaacctgacccagcttaaagctgcagtgggtgagctctcagagaaatccaagctgcaggagatctaccaggagctgacccagctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacggagctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccagctgaaggctgcagtgggtgagttgccagaccagtccaagcagcagcaaatctatcaagaactgaccgatttgaagactgcatttgaacgcctgtgccgccactgtcccaaggactggacattcttccaaggaaactgttacttcatgtctaactcccagcggaactggcacgactccgtcaccgcctgccaggaagtgagggcccagctcgtcgtaatcaaaactgctgaggagcagaacttcctacagctgcagacttccaggagtaaccgcttctcctggatgggactttcagacctaaatcaggaaggcacgtggcaatgggtggacggctcacctctgtcacccagcttccagcggtactggaacagtggagaacccaacaatagcgggaatgaagactgtgcggaatttagtggcagtggctggaacgacaatcgatgtgacgttgacaattactggatctgcaaaaagcccgcagcctgcttcagagacgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: