Login to display prices
Login to display prices
ZCCHC12-zinc finger, CCHC domain containing 12 Gene View larger

ZCCHC12-zinc finger, CCHC domain containing 12 Gene

PTXBC031241

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZCCHC12-zinc finger, CCHC domain containing 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZCCHC12-zinc finger, CCHC domain containing 12 Gene

Proteogenix catalog: PTXBC031241
Ncbi symbol: ZCCHC12
Product name: ZCCHC12-zinc finger, CCHC domain containing 12 Gene
Size: 2ug
Accessions: BC031241
Gene id: 170261
Gene description: zinc finger, CCHC domain containing 12
Synonyms: PNMA7A; SIZN; SIZN1; zinc finger CCHC domain-containing protein 12; paraneoplastic Ma antigen family member 7A; smad-interacting zinc finger protein 1; zinc finger, CCHC domain containing 12; zinc finger CCHC-type containing 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagcatcattgcacgtgtcggtaacagccggcggctgaatgcacccttgccgccttgggcccattccatgctgaggtccctggggagaagtctcggtcctataatggccagcatggcagacagaaacatgaagttgttctcggggagggtggtgccagcccaaggggaagaaacctttgaaaactggctgacccaagtcaatggcgtcctgccagattggaatatgtctgaggaggaaaagctcaagcgcttgatgaaaacccttaggggccctgcccgcgaggtcatgcgtgtgcttcaggcgaccaaccctaacctaagtgtggcagatttcttgcgagccatgaaattggtgtttggggagtctgaaagcagtgtgactgcccatggtaaattttttaacaccctacaagctcaaggggagaaagcctccctttatgtgatccgtttagaggtgcagctccagaacgctattcaggcaggcattatagctgagaaagatgcaaaccggactcgcttgcagcagctccttttaggcggtgagctgagtagggacctccgactcagacttaaggattttctcaggatgtatgcaaatgagcaggagcggcttcccaactttctggagttaatcagaatggtaagggaggaagaggattgggatgatgcttttattaaacggaagcgtccaaaaaggtctgagtcaatggtggagagggcagtcagccctgtggcatttcagggctccccaccgatagtgatcggcagtgctgactgcaatgtgatagagatagatgataccctcgacgactccgatgaggatgtgatcctggtggagtctcaggaccctccacttccatcctggggtgcccctcccctcagagacagggccagacctcaggatgaagtgctggtcattgattccccccacaattccagggctcagtttccttccaccagtggtggttctggctataagaataacggtcctggggagatgcgtagagccaggaagcgaaaacacacaatccgctgttcgtattgtggtgaggaaggccactcaaaagaaacctgtgacaacgagagtgacaaggcccaggtttttgagaatttgatcatcactctccaggagctgacccatactgagatggagaggtcaagagtggcccctggcgaatacaatgacttctctgagccactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: