YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene View larger

YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015625
Product type: DNA & cDNA
Ncbi symbol: YARS2
Origin species: Human
Product name: YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene
Size: 2ug
Accessions: BC015625
Gene id: 51067
Gene description: tyrosyl-tRNA synthetase 2, mitochondrial
Synonyms: CGI-04; MLASA2; MT-TYRRS; TYRRS; tyrosine--tRNA ligase, mitochondrial; tyrosine tRNA ligase 2, mitochondrial; tyrosyl-tRNA synthetase 2, mitochondrial; tyrosyl-tRNA synthetase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccatcttgcggtccttttcctggggccggtggtctggtaccctaaatctctcagtattgttgcccttggggctgcgtaaggcccactcgggcgctcaggggttactggcagcgcagaaggctcgaggtctgttcaaggacttcttcccggagacggggacgaaaatagagctcccagagctcttcgaccgtggcacggcgagttttccccaaaccatttactgtggcttcgaccccacggcagactcgcttcatgtgggtcatctacttgcgctgctgggcctgtttcatttgcagcgagcgggccacaacgtgatcgcgctggtgggaggcgccacggcgcgcctgggagacccgagcggccgtaccaaggaacgcgaggcgctggagacagagcgcgtgcgagccaacgcgcgagctctgcgcctagggcttgaggccctggcggctaatcaccagcagcttttcactgatgggcgctcctggggcagcttcactgtgctggacaactcggcctggtaccagaagcagcacctggtggacttcctggcggcagtggggggtcacttccgcatggggacgctgctgagccggcagagcgtgcagctgcggctcaagagccccgagggcatgagcttggccgagttcttttaccaggtgctccaggcctatgacttctattacctcttccagcgttatggatgcagggtccagctgggcggatctgatcaactaggcaacatcatgtccggatatgagttcatcaacaagttgactggagaagatgtatttggaatcaccgttcctctaattacaagtacaactggagcaaagctgggaaagtctgctggcaacgctgtttggctaaacagagataagacatctccatttgaattgtatcaattctttgtcaggcaaccggacgattcagtggaaaggtacctgaagctgttcactttcctgccccttccagagattgatcatatcatgcagctgcatgtcaaagagccagaaaggcggggtcctcagaaacgactggcagcagaagtaacaaagcttgttcatggacgagaaggattggattctgctaaaaggtgtacacaagccctttatcacagtagcatagatgcactggaggtcatgtctgatcaggagttaaaagagttgtttaaagaagctccattttctgaattttttctcgatcctggaacaagtgtcctagatacttgccgcaaagcaaatgccattccagatggtccccgagggtatcgaatgataacagaaggcggagtcagcataaatcaccaacaagtaacaaatcctgagagtgttttaattgttggacaacatattctcaagaatggactttccttacttaaaataggaaaaagaaatttctacattataaaatggcttcagttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DiGeorge syndrome critical region gene 8
- chromosome 14 open reading frame 133
- DiGeorge syndrome critical region gene 2
- ubiquitin interaction motif containing 1

Buy YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene now

Add to cart