Login to display prices
Login to display prices
YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene View larger

YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene

PTXBC015625

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene

Proteogenix catalog: PTXBC015625
Ncbi symbol: YARS2
Product name: YARS2-tyrosyl-tRNA synthetase 2, mitochondrial Gene
Size: 2ug
Accessions: BC015625
Gene id: 51067
Gene description: tyrosyl-tRNA synthetase 2, mitochondrial
Synonyms: CGI-04; MLASA2; MT-TYRRS; TYRRS; tyrosine--tRNA ligase, mitochondrial; tyrosine tRNA ligase 2, mitochondrial; tyrosyl-tRNA synthetase 2, mitochondrial; tyrosyl-tRNA synthetase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccatcttgcggtccttttcctggggccggtggtctggtaccctaaatctctcagtattgttgcccttggggctgcgtaaggcccactcgggcgctcaggggttactggcagcgcagaaggctcgaggtctgttcaaggacttcttcccggagacggggacgaaaatagagctcccagagctcttcgaccgtggcacggcgagttttccccaaaccatttactgtggcttcgaccccacggcagactcgcttcatgtgggtcatctacttgcgctgctgggcctgtttcatttgcagcgagcgggccacaacgtgatcgcgctggtgggaggcgccacggcgcgcctgggagacccgagcggccgtaccaaggaacgcgaggcgctggagacagagcgcgtgcgagccaacgcgcgagctctgcgcctagggcttgaggccctggcggctaatcaccagcagcttttcactgatgggcgctcctggggcagcttcactgtgctggacaactcggcctggtaccagaagcagcacctggtggacttcctggcggcagtggggggtcacttccgcatggggacgctgctgagccggcagagcgtgcagctgcggctcaagagccccgagggcatgagcttggccgagttcttttaccaggtgctccaggcctatgacttctattacctcttccagcgttatggatgcagggtccagctgggcggatctgatcaactaggcaacatcatgtccggatatgagttcatcaacaagttgactggagaagatgtatttggaatcaccgttcctctaattacaagtacaactggagcaaagctgggaaagtctgctggcaacgctgtttggctaaacagagataagacatctccatttgaattgtatcaattctttgtcaggcaaccggacgattcagtggaaaggtacctgaagctgttcactttcctgccccttccagagattgatcatatcatgcagctgcatgtcaaagagccagaaaggcggggtcctcagaaacgactggcagcagaagtaacaaagcttgttcatggacgagaaggattggattctgctaaaaggtgtacacaagccctttatcacagtagcatagatgcactggaggtcatgtctgatcaggagttaaaagagttgtttaaagaagctccattttctgaattttttctcgatcctggaacaagtgtcctagatacttgccgcaaagcaaatgccattccagatggtccccgagggtatcgaatgataacagaaggcggagtcagcataaatcaccaacaagtaacaaatcctgagagtgttttaattgttggacaacatattctcaagaatggactttccttacttaaaataggaaaaagaaatttctacattataaaatggcttcagttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: