MAT2A-methionine adenosyltransferase II, alpha Gene View larger

MAT2A-methionine adenosyltransferase II, alpha Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAT2A-methionine adenosyltransferase II, alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAT2A-methionine adenosyltransferase II, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001686
Product type: DNA & cDNA
Ncbi symbol: MAT2A
Origin species: Human
Product name: MAT2A-methionine adenosyltransferase II, alpha Gene
Size: 2ug
Accessions: BC001686
Gene id: 4144
Gene description: methionine adenosyltransferase II, alpha
Synonyms: MATA2; MATII; SAMS2; S-adenosylmethionine synthase isoform type-2; MAT 2; MAT-II; adoMet synthase 2; adoMet synthetase 2; methionine adenosyltransferase 2; methionine adenosyltransferase II, alpha; testicular tissue protein Li 121; methionine adenosyltransferase 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacggacagctcaacggcttccacgaggcgttcatcgaggagggcacattccttttcacctcagagtcggtcggggaaggccacccagataagatttgtgaccaaatcagtgatgctgtccttgatgcccaccttcagcaggatcctgatgccaaagtagcttgtgaaactgttgctaaaactggaatgatccttcttgctggggaaattacatccagagctgctgttgactaccagaaagtggttcgtgaagctgttaaacacattggatatgatgattcttccaaaggttttgactacaagacttgtaacgtgctggtagccttggagcaacagtcaccagatattgctcaaggtgttcatcttgacagaaatgaagaagacattggtgctggagaccagggcttaatgtttggctatgccactgatgaaactgaggagtgtatgcctttaaccattgtcttggcacacaagctaaatgccaaactggcagaactacgccgtaatggcactttgccttggttacgccctgattctaaaactcaagttactgtgcagtatatgcaggatcgaggtgctgtgcttcccatcagagtccacacaattgttatatctgttcagcatgatgaagaggtttgtcttgatgaaatgagggatgccctaaaggagaaagtcatcaaagcagttgtgcctgcgaaataccttgatgaggatacaatctaccacctacagccaagtggcagatttgttattggtgggcctcagggtgatgctggtttgactggacgcaaaatcattgtggacacttatggcggttggggtgctcatggaggaggtgccttttcaggaaaggattataccaaggtcgaccgttcagctgcttatgctgctcgttgggtggcaaaatcccttgttaaaggaggtctgtgccggagggttcttgttcaggtctcttatgctattggagtttctcatccattatctatctccattttccattatggtacctctcagaagagtgagagagagctattagagattgtgaagaagaatttcgatctccgccctggggtcattgtcagggatctggatctgaagaagccaatttatcagaggactgcagcctatggccactttggtagggacagcttcccatgggaagtgcccaaaaagcttaaatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 4, member M
- zinc finger, CCHC domain containing 12
- polymerase (RNA) I polypeptide E, 53kDa
- armadillo repeat containing, X-linked 1

Buy MAT2A-methionine adenosyltransferase II, alpha Gene now

Add to cart