Login to display prices
Login to display prices
MAT2A-methionine adenosyltransferase II, alpha Gene View larger

MAT2A-methionine adenosyltransferase II, alpha Gene

PTXBC001686

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAT2A-methionine adenosyltransferase II, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAT2A-methionine adenosyltransferase II, alpha Gene

Proteogenix catalog: PTXBC001686
Ncbi symbol: MAT2A
Product name: MAT2A-methionine adenosyltransferase II, alpha Gene
Size: 2ug
Accessions: BC001686
Gene id: 4144
Gene description: methionine adenosyltransferase II, alpha
Synonyms: MATA2; MATII; SAMS2; S-adenosylmethionine synthase isoform type-2; MAT 2; MAT-II; adoMet synthase 2; adoMet synthetase 2; methionine adenosyltransferase 2; methionine adenosyltransferase II, alpha; testicular tissue protein Li 121; methionine adenosyltransferase 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacggacagctcaacggcttccacgaggcgttcatcgaggagggcacattccttttcacctcagagtcggtcggggaaggccacccagataagatttgtgaccaaatcagtgatgctgtccttgatgcccaccttcagcaggatcctgatgccaaagtagcttgtgaaactgttgctaaaactggaatgatccttcttgctggggaaattacatccagagctgctgttgactaccagaaagtggttcgtgaagctgttaaacacattggatatgatgattcttccaaaggttttgactacaagacttgtaacgtgctggtagccttggagcaacagtcaccagatattgctcaaggtgttcatcttgacagaaatgaagaagacattggtgctggagaccagggcttaatgtttggctatgccactgatgaaactgaggagtgtatgcctttaaccattgtcttggcacacaagctaaatgccaaactggcagaactacgccgtaatggcactttgccttggttacgccctgattctaaaactcaagttactgtgcagtatatgcaggatcgaggtgctgtgcttcccatcagagtccacacaattgttatatctgttcagcatgatgaagaggtttgtcttgatgaaatgagggatgccctaaaggagaaagtcatcaaagcagttgtgcctgcgaaataccttgatgaggatacaatctaccacctacagccaagtggcagatttgttattggtgggcctcagggtgatgctggtttgactggacgcaaaatcattgtggacacttatggcggttggggtgctcatggaggaggtgccttttcaggaaaggattataccaaggtcgaccgttcagctgcttatgctgctcgttgggtggcaaaatcccttgttaaaggaggtctgtgccggagggttcttgttcaggtctcttatgctattggagtttctcatccattatctatctccattttccattatggtacctctcagaagagtgagagagagctattagagattgtgaagaagaatttcgatctccgccctggggtcattgtcagggatctggatctgaagaagccaatttatcagaggactgcagcctatggccactttggtagggacagcttcccatgggaagtgcccaaaaagcttaaatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: