Login to display prices
Login to display prices
HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene View larger

HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene

PTXBC005190

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene

Proteogenix catalog: PTXBC005190
Ncbi symbol: HIBCH
Product name: HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene
Size: 2ug
Accessions: BC005190
Gene id: 26275
Gene description: 3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms: HIBYLCOAH; 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial; 3-hydroxyisobutyryl-Coenzyme A hydrolase; HIB-CoA hydrolase; HIBYL-CoA-H; testicular tissue protein Li 86; 3-hydroxyisobutyryl-CoA hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaggctcatgtcgaggtttaatgcattcaaaaggactaataccatactgcaccatttgagaatgtccaagcacacagatgcagcagaagaggtgctattggaaaaaaaaggttgcgcgggagtcataacactaaacagaccaaagttcctcaatgcactgactcttaatatgattcggcagatttatccacagctaaagaagtgggaacaagatcctgaaactttcctgatcattataaagggagcaggaggaaaggctttctgtgccgggggtgatatcagagtgatctcggaagctgaaaaggcaaaacagaagatagctccagttttcttcagagaagaatatatgctgaataatgctgttggttcttgccagaaaccttatgttgcacttattcatggaattacaatgggtgggggagttggtctctcagtccatgggcaatttcgagtggctacagaaaagtgtctttttgctatgccagaaactgcaataggactgttccctgatgtgggtggaggttatttcttgccacgactccaaggaaaacttggttacttccttgcattaacaggattcagactaaaaggaagagatgtgtacagagcaggaattgctacacactttgtagattctgaaaagttggccatgttagaggaagatttgttagccttgaaatctccttcaaaagaaaatattgcatctgtcttagaaaattaccatacagagtctaagattgatcgagacaagtcttttatacttgaggaacacatggacaaaataaacagttgtttttcagccaatactgtggaagaaattattgaaaacttacagcaagatggttcatcttttgccctagagcaattgaaggtaattaataaaatgtctccaacatctctaaagatcacactaaggcaactcatggaggggtcttcaaagaccttgcaagaagtactaactatggagtatcggctaagtcaagcttgtatgttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: