CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene View larger

CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002568
Product type: DNA & cDNA
Ncbi symbol: CIAPIN1
Origin species: Human
Product name: CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene
Size: 2ug
Accessions: BC002568
Gene id: 57019
Gene description: cytokine induced apoptosis inhibitor 1
Synonyms: Anamorsin; DRE2; PRO0915; fe-S cluster assembly protein DRE2 homolog; cytokine induced apoptosis inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagattttgggatctctgctggccagtttgtggcagtggtctgggataagtcatccccagtggaggctctgaaaggtctggtggataagcttcaagcgttaaccggcaatgagggccgcgtgtctgtggaaaacatcaagcagctgttgcaatctgcccacaaagaatccagctttgacattattttgtcaggtttagtcccaggaagcaccactctgcacagtgctgagattttggctgaaatcgcccggatccttcggcctggtggatgtctttttctgaaggagccagtagagacagctgtagataacaatagcaaagtgaagacagcatctaagctgtgttcagccctgactctttctggtcttgtggaagtgaaagagctgcagcgggagcccctaacccctgaggaagtacagtctgttcgagaacaccttggtcatgaaagtgacaacctgctgtttgttcagatcacaggcaaaaaaccaaactttgaagtgggttcttctaggcagcttaagctttccatcaccaagaagtcttctccttcagtgaaacctgctgtggaccctgctgctgccaagctgtggaccctctcagccaacgatatggaggacgacagcatggatctcattgactcagatgagctgctggatccagaagatttgaagaagccagatccagcttccctgcgggctgcttcttgtggggaagggaaaaagaggaaggcctgtaagaactgcacctgtggccttgccgaagaactggaaaaagagaagtcaagggaacagatgagctcccaacccaagtcagcttgtggaaactgctacctgggcgatgccttccgctgtgccagctgcccctaccttgggatgccagccttcaaacctggggaaaaggtgcttctgagtgatagcaatcttcatgatgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium channel, subfamily K, member 6
- lectin, galactoside-binding, soluble, 8
- ubiquitin carboxyl-terminal hydrolase L5
- enoyl Coenzyme A hydratase 1, peroxisomal

Buy CIAPIN1-cytokine induced apoptosis inhibitor 1 Gene now

Add to cart