Login to display prices
Login to display prices
AIDA-axin interactor, dorsalization associated Gene View larger

AIDA-axin interactor, dorsalization associated Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AIDA-axin interactor, dorsalization associated Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AIDA-axin interactor, dorsalization associated Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015535
Product type: DNA & cDNA
Ncbi symbol: AIDA
Origin species: Human
Product name: AIDA-axin interactor, dorsalization associated Gene
Size: 2ug
Accessions: BC015535
Gene id: 64853
Gene description: axin interactor, dorsalization associated
Synonyms: C1orf80; axin interactor, dorsalization-associated protein; axin interaction partner and dorsalization antagonist; axin interactor, dorsalization associated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggaggtgacccggagtctgctgcagcgctggggcgccagttttaggagaggcgccgacttcgactcttggggccagctggtggaggcgatagacgagtatcagatattagcaagacatctacaaaaggaggcccaagctcaacacaataattctgaattcacagaagaacaaaagaaaaccataggcaaaattgcaacatgcttggaattgcgaagtgcagctttacagtccacacagtctcaagaagaatttaaactggaggacctgaagaagctagaaccaatcctaaagaatattcttacatataataaagaattcccatttgatgttcagcctgtcccattaagaagaattttggcacctggtgaagaagagaatttggaatttgaagaagatgaagaagagggtggtgctggagcagggtctcctgattcttttcctgctagagttcccggtactttattaccaaggttgccatcggaaccaggaatgacattactcactatcagaattgagaaaattggtttgaaagatgctgggcagtgcatcgatccctatattacagttagtgtaaaggatctgaatggcatagacttaactcctgtgcaagatactcctgtggcttcaagaaaagaagatacatatgttcattttaatgtggacattgagctccagaagcatgttgaaaaattaaccaaaggtgcagctatcttctttgaattcaaacactacaagcctaaaaaaaggtttaccagcaccaagtgttttgctttcatggagatggatgaaattaaacctgggccaattgtaatagaactatacaagaaacccactgactttaaaagaaagaaattgcaattattgaccaagaaaccactttatcttcatctacatcaaactttgcacaaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyridoxal (pyridoxine, vitamin B6) kinase
- cytokine induced apoptosis inhibitor 1
- potassium channel, subfamily K, member 6
- lectin, galactoside-binding, soluble, 8