C14orf172-chromosome 14 open reading frame 172 Gene View larger

C14orf172-chromosome 14 open reading frame 172 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf172-chromosome 14 open reading frame 172 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf172-chromosome 14 open reading frame 172 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010167
Product type: DNA & cDNA
Ncbi symbol: C14orf172
Origin species: Human
Product name: C14orf172-chromosome 14 open reading frame 172 Gene
Size: 2ug
Accessions: BC010167
Gene id: 115708
Gene description: chromosome 14 open reading frame 172
Synonyms: C14orf172; GCD14; Gcd14p; TRM61; hTRM61; tRNA (adenine(58)-N(1))-methyltransferase catalytic subunit TRMT61A; tRNA (adenine-N(1)-)-methyltransferase catalytic subunit TRM61; tRNA (adenine-N(1)-)-methyltransferase catalytic subunit TRMT61A; tRNA methyltransferase 61 homolog A; tRNA(m1A58)-methyltransferase subunit TRM61; tRNA(m1A58)-methyltransferase subunit TRMT61A; tRNA(m1A58)MTase subunit TRM61; tRNA(m1A58)MTase subunit TRMT61A; tRNA methyltransferase 61A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcttcgtggcatacgaggagctgatcaaggagggtgacacggccatcctgtcactgggccatggtgcaatggtggcagtgcgtgtgcagcgtggggcacagacccagacccggcatggtgtcctgcggcactcagttgaccttatcggccgccccttcggctccaaggtgacgtgcggccgaggtggctgggtgtatgtgctgcaccccacgcccgagctctggacgctgaacctgccgcaccgcacgcagatcctctactccacagacatcgccctcatcaccatgatgttggagcttcggcccggctctgtggtctgtgagtctggcaccggcagtggctctgtgtcccacgccatcatccgcaccattgcacccacgggtcacctgcacacggtggagttccaccagcagcgggcagagaaggcccgggaggagttccaggagcaccgtgtgggccgctgggtgactgtgcgcacccaggacgtgtgccgcagtggctttggcgtgagccacgtggccgacgccgtcttcctggacatcccatcaccctgggaggccgtgggccacgcctgggacgccctcaaggtcgaaggcgggcgcttctgctccttctcaccgtgcatcgagcaggtgcaacgcacatgccaggcgctggcagcgcgcggcttctcagagctgagcaccctggaggtgctgccacaggtctacaacgtgcgcactgtcagcctgccaccgcccgacctgggcacaggcacagatggccctgccggctccgacaccagccccttccgcagcggcacgcccatgaaggaggccgtgggccacaccggctacctgaccttcgccaccaagaccccaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - armadillo repeat containing, X-linked 6
- protein phosphatase 6, catalytic subunit
- axin interactor, dorsalization associated
- pyridoxal (pyridoxine, vitamin B6) kinase

Buy C14orf172-chromosome 14 open reading frame 172 Gene now

Add to cart