Login to display prices
Login to display prices
CIDEA-cell death-inducing DFFA-like effector a Gene View larger

CIDEA-cell death-inducing DFFA-like effector a Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIDEA-cell death-inducing DFFA-like effector a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CIDEA-cell death-inducing DFFA-like effector a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031896
Product type: DNA & cDNA
Ncbi symbol: CIDEA
Origin species: Human
Product name: CIDEA-cell death-inducing DFFA-like effector a Gene
Size: 2ug
Accessions: BC031896
Gene id: 1149
Gene description: cell death-inducing DFFA-like effector a
Synonyms: CIDE-A; cell death activator CIDE-A; cell death-inducing DFFA-like effector a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaggggaccgggcttctgggggtcctggaaatcacaacgggagctgggcgcgggaggggcccaggcttggcccctcctggaagcgcgggctctggtctccgaggggaggccccaaccgtccggcggagccctccaggcccctgacatttatgggatcacagactaagcgagtcctgttcaccccgctcatgcatccagctcgccctttccgggtctccaaccatgacaggagcagccggcgtggggtgatggcaagcagcctgcaggagctcatcagcaagactctggatgccctcgtcatcgctaccggactggtcactctggtgctggaggaagatggcaccgtggtggacacagaagagttctttcagaccttgggagacaacacgcatttcatgatcttggaaaaaggacagaagtggatgccgggcagccagcacgtccccacttgctcgccgccgaagaggtcgggaatagcgagagtcaccttcgacttgtacaggctgaaccccaaggacttcatcggctgccttaacgtgaaggccaccatgtatgagatgtactccgtgtcctacgacatccggtgcacgggactcaagggcctgctgaggagtctgctgcggttcctgtcctactccgcccaggtgacgggacagtttctcatctatctgggcacatacatgctccgggtgctggatgacaaggaagagcggccatccctccggtcacaagccaagggcaggttcacgtgtggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FYVE and coiled-coil domain containing 1
- OTU domain, ubiquitin aldehyde binding 1
- OTU domain, ubiquitin aldehyde binding 1
- procollagen C-endopeptidase enhancer 2