Login to display prices
Login to display prices
IGLL1-immunoglobulin lambda-like polypeptide 1 Gene View larger

IGLL1-immunoglobulin lambda-like polypeptide 1 Gene

PTXBC012293

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGLL1-immunoglobulin lambda-like polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGLL1-immunoglobulin lambda-like polypeptide 1 Gene

Proteogenix catalog: PTXBC012293
Ncbi symbol: IGLL1
Product name: IGLL1-immunoglobulin lambda-like polypeptide 1 Gene
Size: 2ug
Accessions: BC012293
Gene id: 3543
Gene description: immunoglobulin lambda-like polypeptide 1
Synonyms: AGM2; CD179b; IGL1; IGL5; IGLJ14.1; IGLL; IGO; IGVPB; VPREB2; immunoglobulin lambda-like polypeptide 1; CD179 antigen-like family member B; CD179b antigen; Pre-B lymphocyte-specific protein-2; ig lambda-5; immunoglobulin omega polypeptide chain; immunoglobulin-related 14.1 protein; immunoglobulin-related protein 14.1; lambda5; immunoglobulin lambda like polypeptide 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggccagggacaggccaggggggccttgaggcccctggtgagccaggccccaacctcaggcagcgctggcccctgctgctgctgggtctggccgtggtaacccatggcctgctgcgcccaacagctgcatcgcagagcagggccctgggccctggagcccctggaggaagcagccggtccagcctgaggagccggtggggcaggttcctgctccagcgcggctcctggactggccccaggtgctggccccgggggtttcaatccaagcataactcagtgacgcatgtgtttggcagcgggacccagctcaccgttttaagtcagcccaaggccaccccctcggtcactctgttcccgccgtcctctgaggagctccaagccaacaaggctacactggtgtgtctcatgaatgacttttatccgggaatcttgacggtgacctggaaggcagatggtacccccatcacccagggcgtggagatgaccacgccctccaaacagagcaacaacaagtacgcggccagcagctacctgagcctgacgcccgagcagtggaggtcccgcagaagctacagctgccaggtcatgcacgaagggagcaccgtggagaagacggtggcccctgcagaatgttcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: