Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IGLL1-immunoglobulin lambda-like polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGLL1-immunoglobulin lambda-like polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012293 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGLL1 |
| Origin species: | Human |
| Product name: | IGLL1-immunoglobulin lambda-like polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC012293 |
| Gene id: | 3543 |
| Gene description: | immunoglobulin lambda-like polypeptide 1 |
| Synonyms: | AGM2; CD179b; IGL1; IGL5; IGLJ14.1; IGLL; IGO; IGVPB; VPREB2; immunoglobulin lambda-like polypeptide 1; CD179 antigen-like family member B; CD179b antigen; Pre-B lymphocyte-specific protein-2; ig lambda-5; immunoglobulin omega polypeptide chain; immunoglobulin-related 14.1 protein; immunoglobulin-related protein 14.1; lambda5; immunoglobulin lambda like polypeptide 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggccagggacaggccaggggggccttgaggcccctggtgagccaggccccaacctcaggcagcgctggcccctgctgctgctgggtctggccgtggtaacccatggcctgctgcgcccaacagctgcatcgcagagcagggccctgggccctggagcccctggaggaagcagccggtccagcctgaggagccggtggggcaggttcctgctccagcgcggctcctggactggccccaggtgctggccccgggggtttcaatccaagcataactcagtgacgcatgtgtttggcagcgggacccagctcaccgttttaagtcagcccaaggccaccccctcggtcactctgttcccgccgtcctctgaggagctccaagccaacaaggctacactggtgtgtctcatgaatgacttttatccgggaatcttgacggtgacctggaaggcagatggtacccccatcacccagggcgtggagatgaccacgccctccaaacagagcaacaacaagtacgcggccagcagctacctgagcctgacgcccgagcagtggaggtcccgcagaagctacagctgccaggtcatgcacgaagggagcaccgtggagaagacggtggcccctgcagaatgttcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lysosomal protein transmembrane 4 beta - zinc finger, CCHC domain containing 17 - cell death-inducing DFFA-like effector a - FYVE and coiled-coil domain containing 1 |