Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GUCA1A-guanylate cyclase activator 1A (retina) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GUCA1A-guanylate cyclase activator 1A (retina) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GUCA1A |
| Origin species: | Human |
| Product name: | GUCA1A-guanylate cyclase activator 1A (retina) Gene |
| Size: | 2ug |
| Accessions: | BC031663 |
| Gene id: | 2978 |
| Gene description: | guanylate cyclase activator 1A (retina) |
| Synonyms: | C6orf131; COD3; CORD14; GCAP; GCAP1; GUCA; GUCA1; guanylyl cyclase-activating protein 1; cone dystrophy 3; guanylate cyclase-activating protein, photoreceptor 1; guanylin 1, retina; guanylate cyclase activator 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaacgtgatggagggaaagtcagtggaggagctgagcagcaccgagtgccaccagtggtacaagaagttcatgactgagtgcccctctggccaactcaccctctatgagttccgccagttcttcggcctcaagaacctgagcccgtcggccagccagtacgtggaacagatgtttgagacttttgacttcaacaaggacggctacattgatttcatggagtacgtggcagcgctcagcttggtcctcaaggggaaggtggaacagaagctccgctggtacttcaagctctatgatgtagatggcaacggctgcattgaccgcgatgagctgctcaccatcatccaggccattcgcgccattaacccctgcagcgataccaccatgactgcagaggagttcaccgatacagtgttctccaagattgacgtcaacggggatggggaactctccctggaagagtttatagagggcgtccagaaggaccagatgctcctggacacactgacacgaagcctggaccttacccgcatcgtgcgcaggctccagaatggcgagcaagacgaggagggggctgacgaggccgctgaggcagccggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - immunoglobulin lambda-like polypeptide 1 - lysosomal protein transmembrane 4 beta - zinc finger, CCHC domain containing 17 - cell death-inducing DFFA-like effector a |