Login to display prices
Login to display prices
GUCA1A-guanylate cyclase activator 1A (retina) Gene View larger

GUCA1A-guanylate cyclase activator 1A (retina) Gene

PTXBC031663

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GUCA1A-guanylate cyclase activator 1A (retina) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GUCA1A-guanylate cyclase activator 1A (retina) Gene

Proteogenix catalog: PTXBC031663
Ncbi symbol: GUCA1A
Product name: GUCA1A-guanylate cyclase activator 1A (retina) Gene
Size: 2ug
Accessions: BC031663
Gene id: 2978
Gene description: guanylate cyclase activator 1A (retina)
Synonyms: C6orf131; COD3; CORD14; GCAP; GCAP1; GUCA; GUCA1; guanylyl cyclase-activating protein 1; cone dystrophy 3; guanylate cyclase-activating protein, photoreceptor 1; guanylin 1, retina; guanylate cyclase activator 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaacgtgatggagggaaagtcagtggaggagctgagcagcaccgagtgccaccagtggtacaagaagttcatgactgagtgcccctctggccaactcaccctctatgagttccgccagttcttcggcctcaagaacctgagcccgtcggccagccagtacgtggaacagatgtttgagacttttgacttcaacaaggacggctacattgatttcatggagtacgtggcagcgctcagcttggtcctcaaggggaaggtggaacagaagctccgctggtacttcaagctctatgatgtagatggcaacggctgcattgaccgcgatgagctgctcaccatcatccaggccattcgcgccattaacccctgcagcgataccaccatgactgcagaggagttcaccgatacagtgttctccaagattgacgtcaacggggatggggaactctccctggaagagtttatagagggcgtccagaaggaccagatgctcctggacacactgacacgaagcctggaccttacccgcatcgtgcgcaggctccagaatggcgagcaagacgaggagggggctgacgaggccgctgaggcagccggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice