Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene
PTXBC004308
New product
Data sheet of PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004308 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMG3 |
| Origin species: | Human |
| Product name: | PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene |
| Size: | 2ug |
| Accessions: | BC004308 |
| Gene id: | 84262 |
| Gene description: | proteasome (prosome, macropain) assembly chaperone 3 |
| Synonyms: | C7orf48; PAC3; proteasome assembly chaperone 3; PAC-3; hPAC3; proteasome (prosome, macropain) assembly chaperone 3; proteasome assembling chaperone 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagacacgccgttggtgatatcgaagcagaagacggaggtggtgtgcggggtccccacccaggtggtgtgtacggccttcagcagtcacatcctggtggtggtgacccagtttgggaagatgggcaccctggtctccctggagcccagcagcgtggccagtgacgtcagcaagcctgtgctcaccacaaaagtccttctggggcaggatgagcctctcatccatgtctttgcaaagaacctggtagcgtttgtgtctcaagaagctggaaacagagcagtcctcctcgccgtggccgtgaaggacaaaagcatggaggggctgaaggcgctgagggaggtgatccgggtgtgccaggtgtggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mesoderm induction early response 1, family member 2 - thymocyte selection-associated high mobility group box - histidyl-tRNA synthetase 2, mitochondrial (putative) - janus kinase and microtubule interacting protein 2 |