PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene View larger

PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004308
Product type: DNA & cDNA
Ncbi symbol: PSMG3
Origin species: Human
Product name: PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene
Size: 2ug
Accessions: BC004308
Gene id: 84262
Gene description: proteasome (prosome, macropain) assembly chaperone 3
Synonyms: C7orf48; PAC3; proteasome assembly chaperone 3; PAC-3; hPAC3; proteasome (prosome, macropain) assembly chaperone 3; proteasome assembling chaperone 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagacacgccgttggtgatatcgaagcagaagacggaggtggtgtgcggggtccccacccaggtggtgtgtacggccttcagcagtcacatcctggtggtggtgacccagtttgggaagatgggcaccctggtctccctggagcccagcagcgtggccagtgacgtcagcaagcctgtgctcaccacaaaagtccttctggggcaggatgagcctctcatccatgtctttgcaaagaacctggtagcgtttgtgtctcaagaagctggaaacagagcagtcctcctcgccgtggccgtgaaggacaaaagcatggaggggctgaaggcgctgagggaggtgatccgggtgtgccaggtgtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mesoderm induction early response 1, family member 2
- thymocyte selection-associated high mobility group box
- histidyl-tRNA synthetase 2, mitochondrial (putative)
- janus kinase and microtubule interacting protein 2

Buy PSMG3-proteasome (prosome, macropain) assembly chaperone 3 Gene now

Add to cart