Login to display prices
Login to display prices
CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene View larger

CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene

PTXBC000288

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene

Proteogenix catalog: PTXBC000288
Ncbi symbol: CNBP
Product name: CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene
Size: 2ug
Accessions: BC000288
Gene id: 7555
Gene description: CCHC-type zinc finger, nucleic acid binding protein
Synonyms: CNBP1; DM2; PROMM; RNF163; ZCCHC22; ZNF9; cellular nucleic acid-binding protein; erythroid differentiation-related; sterol regulatory element-binding protein; zinc finger protein 273; zinc finger protein 9 (a cellular retroviral nucleic acid binding protein); CCHC-type zinc finger nucleic acid binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagatatttgttatcgctgtggtgagtctggtcatcttgccaaggattgtgatcttcaggaggatgcctgctataactgcggtagaggtggccacattgccaaggactgcaaggagcccaagagagagcgagagcaatgctgctacaactgtggcaaaccaggccatctggctcgtgactgcgaccatgcagatgagcagaaatgctattcttgtggagaattcggacacattcaaaaagactgcaccaaagtgaagtgctataggtgtggtgaaactggtcatgtagccatcaactgcagcaagacaagtgaagtcaactgttaccgctgtggcgagtcagggcaccttgcacgggaatgcacaattgaggctacagcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: