PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene View larger

PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032663
Product type: DNA & cDNA
Ncbi symbol: PMAIP1
Origin species: Human
Product name: PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene
Size: 2ug
Accessions: BC032663
Gene id: 5366
Gene description: phorbol-12-myristate-13-acetate-induced protein 1
Synonyms: APR; phorbol-12-myristate-13-acetate-induced protein 1; PMA-induced protein 1; adult T cell leukemia-derived PMA-responsive; immediate-early-response protein APR; protein Noxa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgggtacggcgagggaccaagccggatttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctcgccacttgcccttccccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA methyltransferase 12 homolog (S. cerevisiae)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- TBC1 domain family, member 9B (with GRAM domain)
- ATG9 autophagy related 9 homolog A (S. cerevisiae)

Buy PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene now

Add to cart