Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene
PTXBC032663
New product
Data sheet of PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PMAIP1 |
| Origin species: | Human |
| Product name: | PMAIP1-phorbol-12-myristate-13-acetate-induced protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC032663 |
| Gene id: | 5366 |
| Gene description: | phorbol-12-myristate-13-acetate-induced protein 1 |
| Synonyms: | APR; phorbol-12-myristate-13-acetate-induced protein 1; PMA-induced protein 1; adult T cell leukemia-derived PMA-responsive; immediate-early-response protein APR; protein Noxa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgggtacggcgagggaccaagccggatttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctcgccacttgcccttccccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tRNA methyltransferase 12 homolog (S. cerevisiae) - immunoglobulin heavy constant gamma 1 (G1m marker) - TBC1 domain family, member 9B (with GRAM domain) - ATG9 autophagy related 9 homolog A (S. cerevisiae) |