TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene View larger

TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011713
Product type: DNA & cDNA
Ncbi symbol: TRMT12
Origin species: Human
Product name: TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011713
Gene id: 55039
Gene description: tRNA methyltransferase 12 homolog (S. cerevisiae)
Synonyms: TRM12; TYW2; tRNA wybutosine-synthesizing protein 2 homolog; alpha-amino-alpha-carboxypropyl transferase TYW2; homolog of yeast tRNA methyltransferase; tRNA methyltranferase 12 homolog; tRNA(Phe) (4-demethylwyosine(37)-C(7)) aminocarboxypropyltransferase; tRNA-yW-synthesizing protein 2; tRNA methyltransferase 12 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagagaatgtggttgttagcaacatggagagagaaagtgggaagcccgtggctgttgtcgcagttgtgactgagcctcggtttacccagcgatacagagaatatctccagaggcagaaactctttgatacacagcaccgtgtggaaaagatgccggatggctcggtggcgctaccggtgctgggagagacgcttccagagcagcacctgcaggagctgaggaatcgtgttgccccaggcagtccctgtatgctcacgcagctcccggatcctgttccttcgaagagggcccagggttgttcacctgcccaaaaattgtgtcttgaggtgagtcgctgggtggagggtcggggagtcaagtggtcagccgagctggaggctgatttgccccgatcatggcaacggcatggtaatctcttgttgctgagtgaagactgtttccaagccaagcagtggaaaaatctgggaccggaactctgggagaccgttgccttggcacttggcgtccagcgtttggcaaaacgagggcgggtatcaccggatggtactcgaactccagcagtgacactgctgctgggtgaccatggctgggtagagcatgtggataatggtatccgttataagtttgacgtgacccagtgtatgttctcctttggaaacatcactgagaagcttcgagtggcatcgttgtcctgtgctggagaagtgctggtggatctctatgcagggattggttattttacattgcctttcctagttcatgctggtgctgccttcgtccatgcttgtgagtggaatccccatgctgtagttgctctgagaaataaccttgagatcaatggagtagcagatcggtgccaaatacactttggagataacagaaaactgaagctctcaaatattgcagatagggtgatcctggggctgattcccagctctgaagaaggctggcccattgcctgccaagtgttaaggcaggatgctggaggcattttgcatatccaccaaaatgtggaatctttcccagggaagaatcttcaggctcttggagtcagcaaagtagagaaagagcattggctgtatcctcagcaaattaccaccaaccaatggaaaaatggagctaccagggattctaggggaaaaatgctgtcaccagccaccaagccagagtggcaaaggtgggcagaatctgcagaaactcgaatcgccactcttcttcagcaggtgcatgggaaaccatggaagacacaaattctgcacatccaaccagtgaaatcctatgctccccatgtggatcacatagtcctggatctggaatgctgcccctgtccttcagttggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- TBC1 domain family, member 9B (with GRAM domain)
- ATG9 autophagy related 9 homolog A (S. cerevisiae)
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked

Buy TRMT12-tRNA methyltransferase 12 homolog (S. cerevisiae) Gene now

Add to cart