DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene View larger

DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene


New product

Data sheet of DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034942
Product type: DNA & cDNA
Ncbi symbol: DDX3Y
Origin species: Human
Product name: DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene
Size: 2ug
Accessions: BC034942
Gene id: 8653
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Synonyms: ATP-dependent RNA helicase DDX3Y; DBY; DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked; DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked; DEAD box protein 3, Y-chromosomal; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome; DEAD-box helicase 3, Y-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcatgtggtggtgaaaaatgaccctgaactggaccagcagcttgctaatctggacctgaactctgaaaaacagagtggaggagcaagtacagcgagcaaagggcgctatatacctcctcacttaaggaacagagaagcatctaaaggattccatgataaagacagttcaggttggagttgcagcaaagataaggatgcatatagcagttttgggtctcgagattctagaggaaagcctggttatttcagtgaacgtggaagtggatcaaggggaagatttgatgatcgtggacggagtgactatgatggtattggcaatcgtgaaagacctggctttggcagatttgaacggagtggacatagtcgttggtgtgacaagtcagttgaagatgattggtcaaaaccacttccaccaagtgaacgcttggagcaagaactgttttctggaggaaacacggggattaactttgagaaatatgatgatataccagtagaggcaaccggcagtaactgtcctccacatattgagaattttagcgatattgacatgggagaaattatcatggggaacattgaacttactcgctatactcgtcctactccagtgcaaaaacatgccattcctattattaagggaaaaagagacttaatggcttgtgcccaaacaggatctgggaaaactgcagcatttcttttacccatactgagtcagatatatacagatggtccaggagaagctttgaaggctgtgaaggaaaatggaaggtatgggcgccgcaaacaatatccaatatccttggttttagccccaacaagagaattggctgtacagatctatgaggaagccagaaaattttcctaccgatctagagttcgtccttgtgtagtttatggtggtgctgatattggtcagcagattcgggacttagaacgtggatgccacttgttagtagccactccaggacgtctagtggatatgatggaaagaggaaagattggattagacttctgcaagtacttagtgttggatgaagctgataggatgctggatatgggatttgaacctcagatacgtcgtatagttgaacaagatactatgccaccaaagggcgttcgtcacaccatgatgtttagtgctacttttcctaaggaaatacagatgcttgctcgtgactttttggatgaatatatctttttggctgtaggcagagtaggctctacctctgagaacatcacacagaaagtagtttgggtggaagacttagataaacggtcatttctactggacattttaggtgcaacagggagtgattcacttactttagtgtttgtggagaccaaaaagggagcagattccctggaggatttcttataccatgaaggatatgcttgtactagtattcatggagaccggtcacagagagatcgagaggaggcccttcaccagtttcgctcaggaaaaagcccaattctagtggctacagctgtggcagcacgaggactagacatttcaaatgtgagacatgttatcaattttgatttgccaagtgatattgaagaatatgtgcatcgtattggccgtacaggacgtgtaggaaacctgggccttgccacctcattctttaatgaaaaaaatatgaatattacaaaggatttgttggatcttcttgtagaagctaaacaagaagtgccttcttggttggaaaatatggcttatgaacaccactacaagggtggcagtcgtggacgatctaaaagtaatagattcagtggaggatttggtgccagagactatcgacaaagtagtggttccagcagttctggctttggtgctagtcgcggaagcagcagccgcagtggtggaggtggttacggcaacagcagaggatttggtggaggtggctatggaggcttctacaatagtgatggatatggaggaaattataactcccagggggttgactggtggggcaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
- E74-like factor 4 (ets domain transcription factor)
- FAD-dependent oxidoreductase domain containing 2
- adaptor-related protein complex 1, sigma 3 subunit

Buy DDX3Y-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene now

Add to cart