Login to display prices
Login to display prices
DDX3X-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Gene View larger

DDX3X-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Gene

PTXBC011819

New product

Data sheet of DDX3X-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DDX3X-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC011819
Ncbi symbol: DDX3X
Product name: DDX3X-DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Gene
Size: 2ug
Accessions: BC011819
Gene id: 1654
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked
Synonyms: ATP-dependent RNA helicase DDX3X; CAP-Rf; DBX; DDX14; HLP2; MRX102; DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked; DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked; DEAD box protein 3, X-chromosomal; DEAD box, X isoform; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3; DEAD/H box-3; helicase-like protein 2; DEAD-box helicase 3, X-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcatgtggcagtggaaaatgcgctcgggctggaccagcagtttgctggcctagacctgaactcttcagataatcagagtggaggaagtacagccagcaaagggcgctatattcctcctcatttaaggaaccgagaagctactaaaggtttctacgataaagacagttcagggtggagttctagcaaagataaggatgcgtatagcagttttggatctcgtagtgattcaagagggaagtctagcttcttcagtgatcgtggaagtggatcaaggggaaggtttgatgatcgtggacggagtgattacgatggcattggcagccgtggtgacagaagtggctttggcaaatttgaacgtggtggaaacagtcgctggtgtgacaaatcagatgaagatgattggtcaaaaccactcccaccaagtgaacgcttggaacaggaactcttttctggaggcaacactgggattaattttgagaaatacgatgacattccagttgaggcaacaggcaacaactgtcctccacatattgaaagtttcagtgatgttgagatgggagaaattatcatgggaaacattgagcttactcgttatactcgcccaactccagtgcaaaagcatgctattcctattatcaaagagaaaagagacttgatggcttgtgcccaaacagggtctggaaaaactgcagcatttctgttgcccatcttgagtcagatttattcagatggtccaggcgaggctttgagggccatgaaggaaaatggaaggtatgggcgccgcaaacaatacccaatctccttggtattagcaccaacgagagagttggcagtacagatctacgaggaagccagaaaattttcataccgatctagagttcgtccttgcgtggtttatggtggtgccgatattggtcagcagattcgagacttggaacgtggatgccatttgttagtagccactccaggacgtctagtggatatgatggaaagaggaaagattggattagacttttgcaaatacttggtgttagatgaagctgatcggatgttggatatggggtttgagcctcagattcgtagaatagtcgaacaagatactatgcctccaaagggtgtccgccacactatgatgtttagtgctacttttcctaaggaaatacagatgctggctcgtgatttcttagatgaatatatcttcttggctgtaggaagagttggctctacctctgaaaacatcacacagaaagtagtttgggtggaagaatcagacaaacggtcatttctgcttgacctcctaaatgcaacaggcaaggattcactgaccttagtgtttgtggagaccaaaaagggtgcagattctctggaggatttcttataccatgaaggatacgcatgtaccagcatccatggagaccgttctcagagggatagagaagaggcccttcaccagttccgctcaggaaaaagcccaattttagtggctacagcagtagcagcaagaggactggacatttcaaatgtgaaacatgttatcaattttgacttgccaagtgatattgaagaatatgtacatcgtattggtcgtacgggacgtgtaggaaaccttggcctggcaacctcattctttaacgagaggaacataaatattactaaggatttgttggatcttcttgttgaagctaaacaagaagtgccgtcttggttagaaaacatggcttatgaacaccactacaagggtagcagtcgtggacgttctaagagtagcagatttagtggagggtttggtgccagagactaccgacaaagtagcggtgccagcagttccagcttcagcagcagccgcgcaagcagcagccgcagtggcggaggtggccacggtagcagcagaggatttggtggaggtggctatggaggcttttacaacagtgatggatatggaggaaattataactcccagggggttgactggtggggtaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice