SMCP-sperm mitochondria-associated cysteine-rich protein Gene View larger

SMCP-sperm mitochondria-associated cysteine-rich protein Gene

PTXBC014593

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMCP-sperm mitochondria-associated cysteine-rich protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMCP-sperm mitochondria-associated cysteine-rich protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014593
Product type: DNA & cDNA
Ncbi symbol: SMCP
Origin species: Human
Product name: SMCP-sperm mitochondria-associated cysteine-rich protein Gene
Size: 2ug
Accessions: BC014593
Gene id: 4184
Gene description: sperm mitochondria-associated cysteine-rich protein
Synonyms: HSMCSGEN1; MCS; MCSP; sperm mitochondrial-associated cysteine-rich protein; mitochondrial capsule selenoprotein; testicular tissue protein Li 119; testicular tissue protein Li 161; sperm mitochondria associated cysteine rich protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgaccagacaaaacacagtaaatgctgcccagcaaaaggcaatcaatgctgcccaccacagcagaaccagtgctgccagtcaaaaggcaatcaatgctgcccaccaaaacagaaccagtgctgccagccaaaaggcagtcaatgctgcccaccaaaacacaatcactgctgccagccaaaacccccatgctgcattcaggccaggtgctgtggtttggagaccaagcctgaagtctcaccccttaacatggagtctgagcccaactcaccgcaaactcaggacaagggctgtcaaacccagcagcagccccatagcccacaaaatgagtccaggccaagcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATG4 autophagy related 4 homolog D (S. cerevisiae)
- adaptor-related protein complex 2, sigma 1 subunit
- adaptor-related protein complex 1, sigma 3 subunit
- centrin, EF-hand protein, 3 (CDC31 homolog, yeast)

Buy SMCP-sperm mitochondria-associated cysteine-rich protein Gene now

Add to cart