Login to display prices
Login to display prices
CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene View larger

CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005383
Product type: DNA & cDNA
Ncbi symbol: CETN3
Origin species: Human
Product name: CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene
Size: 2ug
Accessions: BC005383
Gene id: 1070
Gene description: centrin, EF-hand protein, 3 (CDC31 homolog, yeast)
Synonyms: CDC31; CEN3; centrin-3; CDC31 yeast homolog; EF-hand superfamily member; centrin, EF-hand protein, 3 (CDC31 homolog, yeast); centrin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttagctctgagaagtgagcttgtagtggacaaaacaaagaggaaaaaaagaagagaactgtctgaggaacagaaacaagaaattaaagatgcttttgaactatttgatacagacaaagatgaagcaatagattatcatgaattaaaggtggcaatgagagccttggggtttgatgtaaaaaaagctgatgtactgaagattcttaaagattatgacagagaagccacagggaaaatcacctttgaagattttaatgaagttgtgacagactggatattggaaagagatccccatgaagaaatactcaaggcatttaaactatttgatgatgatgattcaggtaaaataagcttgaggaatttgcgacgtgttgctagagaattgggtgaaaacatgagtgatgaagaacttcgagctatgatagaagaatttgacaaagatggtgatggagaaataaaccaagaggagttcattgctattatgactggtgacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CCHC-type zinc finger, nucleic acid binding protein
- CKLF-like MARVEL transmembrane domain containing 7
- chromobox homolog 5 (HP1 alpha homolog, Drosophila)
- eukaryotic translation elongation factor 1 beta 2