Login to display prices
Login to display prices
CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene View larger

CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene

PTXBC005383

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene

Proteogenix catalog: PTXBC005383
Ncbi symbol: CETN3
Product name: CETN3-centrin, EF-hand protein, 3 (CDC31 homolog, yeast) Gene
Size: 2ug
Accessions: BC005383
Gene id: 1070
Gene description: centrin, EF-hand protein, 3 (CDC31 homolog, yeast)
Synonyms: CDC31; CEN3; centrin-3; CDC31 yeast homolog; EF-hand superfamily member; centrin, EF-hand protein, 3 (CDC31 homolog, yeast); centrin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttagctctgagaagtgagcttgtagtggacaaaacaaagaggaaaaaaagaagagaactgtctgaggaacagaaacaagaaattaaagatgcttttgaactatttgatacagacaaagatgaagcaatagattatcatgaattaaaggtggcaatgagagccttggggtttgatgtaaaaaaagctgatgtactgaagattcttaaagattatgacagagaagccacagggaaaatcacctttgaagattttaatgaagttgtgacagactggatattggaaagagatccccatgaagaaatactcaaggcatttaaactatttgatgatgatgattcaggtaaaataagcttgaggaatttgcgacgtgttgctagagaattgggtgaaaacatgagtgatgaagaacttcgagctatgatagaagaatttgacaaagatggtgatggagaaataaaccaagaggagttcattgctattatgactggtgacatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice