Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene
PTXBC010116
New product
Data sheet of CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010116 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMTM7 |
| Origin species: | Human |
| Product name: | CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene |
| Size: | 2ug |
| Accessions: | BC010116 |
| Gene id: | 112616 |
| Gene description: | CKLF-like MARVEL transmembrane domain containing 7 |
| Synonyms: | CKLFSF7; CKLF-like MARVEL transmembrane domain-containing protein 7; chemokine-like factor super family 7; chemokine-like factor super family member 7 variant 2; chemokine-like factor superfamily 7; chemokine-like factor superfamily member 7; CKLF like MARVEL transmembrane domain containing 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromobox homolog 5 (HP1 alpha homolog, Drosophila) - eukaryotic translation elongation factor 1 beta 2 - E74-like factor 5 (ets domain transcription factor) - heterogeneous nuclear ribonucleoprotein C (C1/C2) |