Login to display prices
Login to display prices
CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene View larger

CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010116
Product type: DNA & cDNA
Ncbi symbol: CMTM7
Origin species: Human
Product name: CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene
Size: 2ug
Accessions: BC010116
Gene id: 112616
Gene description: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: CKLFSF7; CKLF-like MARVEL transmembrane domain-containing protein 7; chemokine-like factor super family 7; chemokine-like factor super family member 7 variant 2; chemokine-like factor superfamily 7; chemokine-like factor superfamily member 7; CKLF like MARVEL transmembrane domain containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromobox homolog 5 (HP1 alpha homolog, Drosophila)
- eukaryotic translation elongation factor 1 beta 2
- E74-like factor 5 (ets domain transcription factor)
- heterogeneous nuclear ribonucleoprotein C (C1/C2)