Login to display prices
Login to display prices
CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene View larger

CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene

PTXBC010116

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene

Proteogenix catalog: PTXBC010116
Ncbi symbol: CMTM7
Product name: CMTM7-CKLF-like MARVEL transmembrane domain containing 7 Gene
Size: 2ug
Accessions: BC010116
Gene id: 112616
Gene description: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: CKLFSF7; CKLF-like MARVEL transmembrane domain-containing protein 7; chemokine-like factor super family 7; chemokine-like factor super family member 7 variant 2; chemokine-like factor superfamily 7; chemokine-like factor superfamily member 7; CKLF like MARVEL transmembrane domain containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice