Login to display prices
Login to display prices
CBX5-chromobox homolog 5 (HP1 alpha homolog, Drosophila) Gene View larger

CBX5-chromobox homolog 5 (HP1 alpha homolog, Drosophila) Gene

PTXBC006821

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBX5-chromobox homolog 5 (HP1 alpha homolog, Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CBX5-chromobox homolog 5 (HP1 alpha homolog, Drosophila) Gene

Proteogenix catalog: PTXBC006821
Ncbi symbol: CBX5
Product name: CBX5-chromobox homolog 5 (HP1 alpha homolog, Drosophila) Gene
Size: 2ug
Accessions: BC006821
Gene id: 23468
Gene description: chromobox homolog 5 (HP1 alpha homolog, Drosophila)
Synonyms: HEL25; HP1; HP1A; chromobox protein homolog 5; HP1 alpha homolog; HP1-ALPHA; HP1Hs alpha; antigen p25; chromobox homolog 5 (HP1 alpha homolog, Drosophila); epididymis luminal protein 25; heterochromatin protein 1 homolog alpha; heterochromatin protein 1-alpha; chromobox 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaagaaaaccaagcggacagctgacagttcttcttcagaggatgaggaggagtatgttgtggagaaggtgctagacaggcgcgtggttaagggacaagtggaatatctactgaagtggaaaggcttttctgaggagcacaatacttgggaacctgagaaaaacttggattgccctgagctaatttctgaatttatgaaaaagtataagaagatgaaggagggtgaaaataataaacccagggagaagtcagaaagtaacaagaggaaatccaatttctcaaacagtgccgatgacatcaaatctaaaaaaaagagagagcagagcaatgatatcgctcggggctttgagagaggactggaaccagaaaagatcattggggcaacagattcctgtggtgatttaatgttcctaatgaaatggaaagacacagatgaagctgacctggttcttgcaaaagaagctaatgtgaaatgtccacaaattgtgatagcattttatgaagagagactgacatggcatgcatatcctgaggatgcggaaaacaaagagaaagaaacagcaaagagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice