Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene
PTXBC014911
New product
Data sheet of CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014911 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CNBP |
| Origin species: | Human |
| Product name: | CNBP-CCHC-type zinc finger, nucleic acid binding protein Gene |
| Size: | 2ug |
| Accessions: | BC014911 |
| Gene id: | 7555 |
| Gene description: | CCHC-type zinc finger, nucleic acid binding protein |
| Synonyms: | CNBP1; DM2; PROMM; RNF163; ZCCHC22; ZNF9; cellular nucleic acid-binding protein; erythroid differentiation-related; sterol regulatory element-binding protein; zinc finger protein 273; zinc finger protein 9 (a cellular retroviral nucleic acid binding protein); CCHC-type zinc finger nucleic acid binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagacatttgttatcgctgtggtgagtctggtcatcttgccaaggattgtgatcttcaggaggatgcctgctataactgcggtagaggtggccacattgccaaggactgcaaggagcccaagagagagcgagagcaatgctgctacaactgtggcaaaccaggccatctggctcgtgactgcgaccatgcagatgagcagaaatgctattcttgtggagaattcggacacattcaaaaagactgcaccaaagtgaagtgctataggtgtggtgaaactggtcatgtagccatcaactgcagcaagacaagtgaagtcaactgttaccgctgtggcgagtcagggcaccttgcacgggaatgcacaattgaggctacagcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CKLF-like MARVEL transmembrane domain containing 7 - chromobox homolog 5 (HP1 alpha homolog, Drosophila) - eukaryotic translation elongation factor 1 beta 2 - E74-like factor 5 (ets domain transcription factor) |