Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene
PTXBC009606
New product
Data sheet of AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009606 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP1S3 |
| Origin species: | Human |
| Product name: | AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene |
| Size: | 2ug |
| Accessions: | BC009606 |
| Gene id: | 130340 |
| Gene description: | adaptor-related protein complex 1, sigma 3 subunit |
| Synonyms: | PSORS15; AP-1 complex subunit sigma-3; adapter-related protein complex 1 subunit sigma-1C; adaptor protein complex AP-1 sigma-1C subunit; adaptor-related protein complex 1 subunit sigma-1C; clathrin assembly protein complex 1 sigma-1C small chain; golgi adaptor HA1/AP1 adaptin sigma-1C subunit; sigma 1C subunit of AP-1 clathrin; adaptor related protein complex 1 sigma 3 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatacatttcatattgctcttcagtcgacaagggaaattacggctacagaaatggtacatcactctccctgataaagagaggaagaagatcacccgggaaattgttcagattattctctcccgtggtcacaggacaagcagttttgttgactggaaggagctaaaacttgtttataaaaggtatgctagtttatatttttgctgtgcaatagaaaatcaggacaatgagctcttgacgctagagattgtgcatcgttacgtggagctgctggacaaatattttggaaatgtctgtgagctggatattatctttaattttgaaaaggcttatttcatcctggacgagtttataataggtggggaaattcaggaaacatccaagaaaattgctgtcaaagccattgaagactctgatatgttacaggagaatcgtttgagccccagaggcagagattgcagtgagccgagatcatgccattgcactctagcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrin, EF-hand protein, 3 (CDC31 homolog, yeast) - CCHC-type zinc finger, nucleic acid binding protein - CKLF-like MARVEL transmembrane domain containing 7 - chromobox homolog 5 (HP1 alpha homolog, Drosophila) |