Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AP2S1-adaptor-related protein complex 2, sigma 1 subunit Gene
PTXBC006337
New product
Data sheet of AP2S1-adaptor-related protein complex 2, sigma 1 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP2S1-adaptor-related protein complex 2, sigma 1 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006337 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP2S1 |
| Origin species: | Human |
| Product name: | AP2S1-adaptor-related protein complex 2, sigma 1 subunit Gene |
| Size: | 2ug |
| Accessions: | BC006337 |
| Gene id: | 1175 |
| Gene description: | adaptor-related protein complex 2, sigma 1 subunit |
| Synonyms: | AP17; CLAPS2; FBH3; FBHOk; HHC3; AP-2 complex subunit sigma; HA2 17 kDa subunit; adaptor protein complex AP-2 subunit sigma; clathrin assembly protein 2 sigma small chain; clathrin coat assembly protein AP17; clathrin coat-associated protein AP17; clathrin-associated/assembly/adaptor protein, small 2 (17kD); plasma membrane adaptor AP-2 17 kDa protein; sigma2-adaptin; adaptor related protein complex 2 sigma 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccgctttatcctcatccagaaccgggcaggcaagacgcgcctggccaagtggtacatgcagtttgatgatgatgagaaacagaagctgatcgaggaggtgcatgccgtggtcaccgtccgagacgccaaacacaccaactttgtggagttccggaactttaagatcatttaccgccgctatgctggcctctacttctgcatctgtgtggatgtcaatgacaacaacctggcttacctggaggccattcacaacttcgtggaggtcttaaacgaatatttccacaatgtctgtgaactggacctggtgttcaacttctacaaggtttacacggtcgtggacgagatgttcctggctggcgaaatccgagagaccagccagacgaaggtgctgaaacagctgctgatgctacagtccctggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adaptor-related protein complex 1, sigma 3 subunit - centrin, EF-hand protein, 3 (CDC31 homolog, yeast) - CCHC-type zinc finger, nucleic acid binding protein - CKLF-like MARVEL transmembrane domain containing 7 |