HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene View larger

HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001691
Product type: DNA & cDNA
Ncbi symbol: HCCS
Origin species: Human
Product name: HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene
Size: 2ug
Accessions: BC001691
Gene id: 3052
Gene description: holocytochrome c synthase (cytochrome c heme-lyase)
Synonyms: CCHL; LSDMCA1; MCOPS7; MLS; cytochrome c-type heme lyase; cytochrome c heme-lyase; holocytochrome c-type synthase; microphthalamia with linear skin defects; holocytochrome c synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtttgtctccatctgctcctgctgttgcagttcaggcctcaaatgcttcagcgtccccaccttcaggatgcccgatgcatgaagggaaaatgaaaggctgtccagtgaatacagagccatctggcccaacctgtgagaagaaaacatactctgtgcctgcccaccaggaacgcgcctatgagtacgtggagtgtcccattaggggcactgcggctgagaataaggagaacctagatccttcaaatctgatgccaccaccaaatcaaacaccagctccagatcagccatttgcattgtctactgtcagagaagagtcatccattccgagagcagattcagagaaaaagtgggtttacccttctgagcagatgttctggaatgcaatgttaaagaaagggtggaagtggaaggatgaggatatcagtcagaaggatatgtataatatcattagaattcacaatcagaataacgagcaggcttggaaggagattttgaagtgggaagcccttcatgctgcagagtgtccttgtggtccatcattgatccggtttggagggaaagcaaaagagtattcaccaagggcacgaattcgttcctggatggggtatgagttgccttttgataggcacgattggatcataaaccgttgcgggacagaagttagatatgtgattgattattatgatggtggtgaagtcaacaaggactaccagttcaccatcctggacgtccgtcctgccttagattcactttcggcagtatgggacagaatgaaagtcgcttggtggcgttggacctcgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - basic leucine zipper transcription factor, ATF-like
- phorbol-12-myristate-13-acetate-induced protein 1
- tRNA methyltransferase 12 homolog (S. cerevisiae)
- immunoglobulin heavy constant gamma 1 (G1m marker)

Buy HCCS-holocytochrome c synthase (cytochrome c heme-lyase) Gene now

Add to cart