Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BATF-basic leucine zipper transcription factor, ATF-like Gene
PTXBC032294
New product
Data sheet of BATF-basic leucine zipper transcription factor, ATF-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BATF-basic leucine zipper transcription factor, ATF-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032294 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BATF |
| Origin species: | Human |
| Product name: | BATF-basic leucine zipper transcription factor, ATF-like Gene |
| Size: | 2ug |
| Accessions: | BC032294 |
| Gene id: | 10538 |
| Gene description: | basic leucine zipper transcription factor, ATF-like |
| Synonyms: | B-ATF; BATF1; SFA-2; SFA2; basic leucine zipper transcriptional factor ATF-like; B-cell-activating transcription factor; SF-HT-activated gene 2 protein; activating transcription factor B; basic leucine zipper transcription factor, ATF-like; basic leucine zipper ATF-like transcription factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcacagctccgacagcagtgactccagcttcagccgctctcctccccctggcaaacaggactcatctgatgatgtgagaagagttcagaggagggagaaaaatcgtattgccgcccagaagagccgacagaggcagacacagaaggccgacaccctgcacctggagagcgaagacctggagaaacagaacgcggctctacgcaaggagatcaagcagctcacagaggaactgaagtacttcacgtcggtgctgaacagccacgagcccctgtgctcggtgctggccgccagcacgccctcgccccccgaggtggtgtacagcgcccacgcattccaccaacctcatgtcagctccccgcgcttccagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phorbol-12-myristate-13-acetate-induced protein 1 - tRNA methyltransferase 12 homolog (S. cerevisiae) - immunoglobulin heavy constant gamma 1 (G1m marker) - TBC1 domain family, member 9B (with GRAM domain) |