ALKBH1-alkB, alkylation repair homolog 1 (E. coli) Gene View larger

ALKBH1-alkB, alkylation repair homolog 1 (E. coli) Gene

PTXBC025787

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALKBH1-alkB, alkylation repair homolog 1 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALKBH1-alkB, alkylation repair homolog 1 (E. coli) Gene

Proteogenix catalog: PTXBC025787
Ncbi symbol: ALKBH1
Product name: ALKBH1-alkB, alkylation repair homolog 1 (E. coli) Gene
Size: 2ug
Accessions: BC025787
Gene id: 8846
Gene description: alkB, alkylation repair homolog 1 (E. coli)
Synonyms: DNA oxidative demethylase ALKBH1; DNA demethylase ALKBH1; ABH; ABH1; ALKBH; alkB; hABH; DNA 6mA demethylase; DNA N6-methyl adenine demethylase; DNA lyase ABH1; alkB, alkylation repair homolog 1; alkylated DNA repair protein alkB homolog 1; alkylation repair, alkB homolog; alpha-ketoglutarate-dependent dioxygenase ABH1; alkB homolog 1, histone H2A dioxygenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaagatggcagcggccgtgggctctgtggcgactctggcgactgagcccggggaggacgcctttcggaaacttttccgcttctaccgtcagagccggcccgggaccgcagacctggaaggggtcatcgacttctcggcggcccacgcagcccgtggcaagggtcctggtgcccaaaaggtgatcaaatctcagctaaatgtgtcttctgtcagtgagcagaatgcatatagagcaggtcttcagcccgtcagcaagtggcaagcctatggactcaaaggctatcctgggtttatttttatcccaaaccccttcctcccaggttaccagtggcactgggtgaaacagtgccttaagttatattcccagaaacctaatgtatgtaacctggacaaacacatgtctaaagaagagacccaagatctgtgggaacagagcaaagagttcctgaggtataaagaagcgactaaacggagaccccgaagtttactggagaaactgcgttgggtgaccgtaggctaccattataactgggacagtaagaaatactcagcagatcattacacacctttcccttctgacctgggtttcctctcagagcaagtagccgctgcctgtggatttgaggatttccgagctgaagcagggatcctgaattactaccgcctggactccacactgggaatccacgtagacagatctgagctagatcactccaaacccttgctgtcattcagctttggacagtccgccatctttctcctgggtggtcttcaaagggatgaggcccccacggccatgtttatgcacagtggtgacatcatgataatgtcgggtttcagccgcctcttgaaccacgcagtccctcgtgtccttccaaatccagaaggggaaggcctgcctcactgcctagaggcacctctccctgctgtcctcccgagagattcaatggtagagccttgttctatggaggactggcaggtgtgtgccagctacttgaagaccgctcgtgttaacatgactgtccgacaggtcctggccacagaccagaatttccctctagaacccatcgaggatgaaaaaagagacatcagtacagaaggtttctgccatctggatgaccagaatagcgaagtaaaacgggccaggataaaccctcacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice