ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene View larger

ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015107
Product type: DNA & cDNA
Ncbi symbol: ACTR6
Origin species: Human
Product name: ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene
Size: 2ug
Accessions: BC015107
Gene id: 64431
Gene description: ARP6 actin-related protein 6 homolog (yeast)
Synonyms: ARP6; CDA12; HSPC281; MSTP136; hARP6; hARPX; actin-related protein 6; ARP6 actin-related protein 6 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaccttagtgctggataatggagcttacaacgccaaaatcggttacagccatgaaaatgtgtcggttattcctaattgtcagttccggtcaaaaacagcacgtcttaaaacttttactgccaaccagatagatgaaataaaagacccttctggactcttttacatcctcccttttcaaaagggctacttggtgaattgggatgttcagagacaagtttgggattacctttttggaaaagaaatgtatcaggttgattttttagatactaatattattatcactgaaccatactttaacttcacttcaattcaagaatcaatgaatgaaattctatttgaagaataccagtttcaagcagtattaagagtaaatgctggggctctcagtgcacataggtatttccgagataatccttccgaattatgctgtatcattgttgatagtggatattcctttacacatatagttccttattgtagaagtaaaaagaaaaaagaagcaattattcggataaatgtgggaggaaaactcttaaccaatcatctaaaggagatcatatcttacaggcagctacatgttatggatgaaacacatgtgattaatcaagtgaaagaagatgtatgctatgtgtctcaggatttttatagagacatggatattgcaaagttgaaaggagaagaaaatacagtaatgatagactatgtcttgcctgacttcagtacaattaaaaagggcttttgtaagccaagggaagagatggtgttgagtggaaaatacaaatctggggaacaaattcttcgtttggccaatgagagatttgctgttccggaaatactctttaatccttctgatataggcattcaagaaatgggaattccagaagctattgtctattcaattcaaaatctacctgaagaaatgcagccgcatttttttaagaacattgtcttgacaggaggaaattcccttttcccaggatttagggatcgggtttactcagaagttcgatgtcttactccaacagattatgatgtttctgttgtgctgcctgaaaaccctattacttatgcctgggaaggtggaaaattgatatcagagaatgatgattttgaagatatggtggtaacaagagaagattacgaagaaaatggacatagcgtctgtgaagagaaatttgatatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - branched chain ketoacid dehydrogenase kinase
- von Willebrand factor A domain containing 5A
- gastric intrinsic factor (vitamin B synthesis)
- ankyrin repeat and MYND domain containing 2

Buy ACTR6-ARP6 actin-related protein 6 homolog (yeast) Gene now

Add to cart