Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene
PTXBC003581
New product
Data sheet of URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003581 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | URM1 |
| Origin species: | Human |
| Product name: | URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC003581 |
| Gene id: | 81605 |
| Gene description: | ubiquitin related modifier 1 homolog (S. cerevisiae) |
| Synonyms: | C9orf74; ubiquitin-related modifier 1; ubiquitin-related modifier 1 homolog; ubiquitin related modifier 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcgcccttgtcagtggaggtggagttcggaggtggtgcggagctcctgtttgacggtattaagaaacatcgagtcactttgcctggacaggaggaaccctgggacatccggaacctgctcatctggatcaagaagaatttgctaaaagagcggccagagttgttcatccagggagacagcgtgcggccaggaattctggtgctgattaacgatgccgactgggagctactgggtgagctggactaccagcttcaggaccaggacagcgtcctcttcatctccactctgcacggcggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coagulation factor III (thromboplastin, tissue factor) - dolichyl-phosphate mannosyltransferase polypeptide 3 - olfactory receptor, family 8, subfamily B, member 8 - olfactory receptor, family 2, subfamily C, member 1 |