Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DPM3-dolichyl-phosphate mannosyltransferase polypeptide 3 Gene
PTXBC104202
New product
Data sheet of DPM3-dolichyl-phosphate mannosyltransferase polypeptide 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DPM3-dolichyl-phosphate mannosyltransferase polypeptide 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104202 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DPM3 |
| Origin species: | Human |
| Product name: | DPM3-dolichyl-phosphate mannosyltransferase polypeptide 3 Gene |
| Size: | 2ug |
| Accessions: | BC104202 |
| Gene id: | 54344 |
| Gene description: | dolichyl-phosphate mannosyltransferase polypeptide 3 |
| Synonyms: | CDG1O; dolichol-phosphate mannosyltransferase subunit 3; DPM synthase complex subunit 3; DPM synthase subunit 3; MPD synthase subunit 3; dolichol-phosphate mannose synthase subunit 3; dolichyl-phosphate beta-D-mannosyltransferase subunit 3; dolichyl-phosphate mannosyltransferase polypeptide 3; mannose-P-dolichol synthase subunit 3; prostin 1; testicular tissue protein Li 58; dolichyl-phosphate mannosyltransferase subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctctccgtgggcgggcttcggttgagtttggtccgcttttcctttctgctcctcaggggagcattgcttccttctctcgcagtgaccatgacgaaattagcgcagtggctttggggactagcgatcctgggctccacctgggtggccctgaccacgggagccttgggcctggagctgcccttgtcctgccaggaagtcctgtggccactgcccgcctacttgctggtgtccgccggctgctatgccctgggcactgtgggctatcgtgtggccacttttcatgactgcgaggacgccgcacgcgagctgcagagccagatacaggaggcccgagccgacttagcccgcagggggctgcgcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 8, subfamily B, member 8 - olfactory receptor, family 2, subfamily C, member 1 - cylicin, basic protein of sperm head cytoskeleton 2 - Zic family member 3 (odd-paired homolog, Drosophila) |