Login to display prices
Login to display prices
MTRF1L-mitochondrial translational release factor 1-like Gene View larger

MTRF1L-mitochondrial translational release factor 1-like Gene

PTXBC014428

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTRF1L-mitochondrial translational release factor 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTRF1L-mitochondrial translational release factor 1-like Gene

Proteogenix catalog: PTXBC014428
Ncbi symbol: MTRF1L
Product name: MTRF1L-mitochondrial translational release factor 1-like Gene
Size: 2ug
Accessions: BC014428
Gene id: 54516
Gene description: mitochondrial translational release factor 1-like
Synonyms: HMRF1L; MRF1L; mtRF1a; peptide chain release factor 1-like, mitochondrial; mitochondrial release factor 1 like; mitochondrial translational release factor 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggtcccgggttctgtggggcgctgcccggtggctctggccccgccgggccgttggcccagcccgccggcccctgagctccggtagcccgccgctggaggagctgttcacccggggcgggcccttgcggaccttcctcgagcgccaggcggggtctgaagcccatttgaaggtcaggaggcccgagttgctggcggtgatcaaactgctgaacgagaaggagcgggagctgcgggagactgagcacttgctgcacgatgagaatgaagatttaaggaaacttgcagagaatgaaatcactttgtgtcaaaaagaaataactcagctgaagcatcagattatcttacttttggttccctcagaagaaacagatgaaaatgatttgatcctggaagtaactgcaggagttggaggtcaggaggcaatgttgtttacatcagagatatttgatatgtatcagcaatatgctgcatttaaaagatggcattttgaaaccctggaatattttccaagtgaactaggtggccttagacatgcatctgccagcattgggggttcagaagcctataggcacatgaaatttgaaggaggtgttcacagagtacaaagagtgccaaagacagaaaagcaaggccgcgtccatactagcaccatgactgtagcaatattaccccagcctactgagattaatctggtgattaatccgaaagatttgagaattgacactaagcgagccagtggagctggggggcagcatgtaaataccacggacagtgctgtccggatagttcatcttccaacagattggaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: