MTRF1L-mitochondrial translational release factor 1-like Gene View larger

MTRF1L-mitochondrial translational release factor 1-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTRF1L-mitochondrial translational release factor 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTRF1L-mitochondrial translational release factor 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014428
Product type: DNA & cDNA
Ncbi symbol: MTRF1L
Origin species: Human
Product name: MTRF1L-mitochondrial translational release factor 1-like Gene
Size: 2ug
Accessions: BC014428
Gene id: 54516
Gene description: mitochondrial translational release factor 1-like
Synonyms: HMRF1L; MRF1L; mtRF1a; peptide chain release factor 1-like, mitochondrial; mitochondrial release factor 1 like; mitochondrial translational release factor 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggtcccgggttctgtggggcgctgcccggtggctctggccccgccgggccgttggcccagcccgccggcccctgagctccggtagcccgccgctggaggagctgttcacccggggcgggcccttgcggaccttcctcgagcgccaggcggggtctgaagcccatttgaaggtcaggaggcccgagttgctggcggtgatcaaactgctgaacgagaaggagcgggagctgcgggagactgagcacttgctgcacgatgagaatgaagatttaaggaaacttgcagagaatgaaatcactttgtgtcaaaaagaaataactcagctgaagcatcagattatcttacttttggttccctcagaagaaacagatgaaaatgatttgatcctggaagtaactgcaggagttggaggtcaggaggcaatgttgtttacatcagagatatttgatatgtatcagcaatatgctgcatttaaaagatggcattttgaaaccctggaatattttccaagtgaactaggtggccttagacatgcatctgccagcattgggggttcagaagcctataggcacatgaaatttgaaggaggtgttcacagagtacaaagagtgccaaagacagaaaagcaaggccgcgtccatactagcaccatgactgtagcaatattaccccagcctactgagattaatctggtgattaatccgaaagatttgagaattgacactaagcgagccagtggagctggggggcagcatgtaaataccacggacagtgctgtccggatagttcatcttccaacagattggaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GTP binding protein overexpressed in skeletal muscle
- activating signal cointegrator 1 complex subunit 1
- ubiquitin-like 7 (bone marrow stromal cell-derived)
- diacylglycerol O-acyltransferase homolog 2 (mouse)

Buy MTRF1L-mitochondrial translational release factor 1-like Gene now

Add to cart