UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene View larger

UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene

PTXBC007913

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007913
Product type: DNA & cDNA
Ncbi symbol: UBL7
Origin species: Human
Product name: UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene
Size: 2ug
Accessions: BC007913
Gene id: 84993
Gene description: ubiquitin-like 7 (bone marrow stromal cell-derived)
Synonyms: BMSC-UbP; TCBA1; ubiquitin-like protein 7; ubiquitin-like 7 (bone marrow stromal cell-derived); ubiquitin-like protein SB132; ubiquitin like 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctctctcagactggcacctggcggtgaagctggctgaccagccacttactccaaagtctattcttcggttgccagagacagaactgggagaatactcgctagggggctatagtatttcatttctgaagcagcttattgctggcaaactccaggagtctgttccagaccctgagctgattgatctgatctactgtggtcggaagctaaaagatgaccagacacttgacttctatggcattcaacctgggtccactgtccatgttctgcgaaagtcctggcctgaacctgatcagaaaccggaacctgtggacaaagtggctgccatgagagagttccgggtgttgcacactgccctgcacagcagctcctcttacagggaggcggtctttaagatgctcagcaataaggagtctctggatcagatcattgtggccaccccaggcctcagcagtgaccctattgctcttggggttctccaggacaaggacctcttctctgtcttcgctgatcccaatatgcttgatacgttggtgcctgctcacccagccctcgtcaatgccattgtcctggttctgcactccgtagcaggcagtgccccaatgcctgggactgactcctcttcccggagcatgccctccagctcataccgggatatgccaggtggcttcctgtttgaagggctctcagatgatgaggatgactttcacccaaacaccaggtccacaccctctagcagtactcccagctcccgcccagcctccctggggtacagtggagctgctgggccccggcccatcacccagagtgagctggccaccgccttggccctggccagcactccggagagcagctctcacacaccgactcctggcacccagggtcattcctcagggacctcaccaatgtcctctggtgtccagtcagggacgcccatcaccaatgatctcttcagccaagccctacagcatgcccttcaggcctctgggcagcccagccttcagagccagtggcagccccagctgcagcagctacgtgacatgggcatccaggacgatgagctgagcctgcgggccctgcaggccaccggtggggacatccaagcagccctggagctcatctttgctggaggagccccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - diacylglycerol O-acyltransferase homolog 2 (mouse)
- TBC1 domain family, member 9B (with GRAM domain)
- prolyl-tRNA synthetase 2, mitochondrial (putative)
- cAMP responsive element binding protein 3-like 1

Buy UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene now

Add to cart