Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene
PTXBC007913
New product
Data sheet of UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007913 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBL7 |
| Origin species: | Human |
| Product name: | UBL7-ubiquitin-like 7 (bone marrow stromal cell-derived) Gene |
| Size: | 2ug |
| Accessions: | BC007913 |
| Gene id: | 84993 |
| Gene description: | ubiquitin-like 7 (bone marrow stromal cell-derived) |
| Synonyms: | BMSC-UbP; TCBA1; ubiquitin-like protein 7; ubiquitin-like 7 (bone marrow stromal cell-derived); ubiquitin-like protein SB132; ubiquitin like 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctctctcagactggcacctggcggtgaagctggctgaccagccacttactccaaagtctattcttcggttgccagagacagaactgggagaatactcgctagggggctatagtatttcatttctgaagcagcttattgctggcaaactccaggagtctgttccagaccctgagctgattgatctgatctactgtggtcggaagctaaaagatgaccagacacttgacttctatggcattcaacctgggtccactgtccatgttctgcgaaagtcctggcctgaacctgatcagaaaccggaacctgtggacaaagtggctgccatgagagagttccgggtgttgcacactgccctgcacagcagctcctcttacagggaggcggtctttaagatgctcagcaataaggagtctctggatcagatcattgtggccaccccaggcctcagcagtgaccctattgctcttggggttctccaggacaaggacctcttctctgtcttcgctgatcccaatatgcttgatacgttggtgcctgctcacccagccctcgtcaatgccattgtcctggttctgcactccgtagcaggcagtgccccaatgcctgggactgactcctcttcccggagcatgccctccagctcataccgggatatgccaggtggcttcctgtttgaagggctctcagatgatgaggatgactttcacccaaacaccaggtccacaccctctagcagtactcccagctcccgcccagcctccctggggtacagtggagctgctgggccccggcccatcacccagagtgagctggccaccgccttggccctggccagcactccggagagcagctctcacacaccgactcctggcacccagggtcattcctcagggacctcaccaatgtcctctggtgtccagtcagggacgcccatcaccaatgatctcttcagccaagccctacagcatgcccttcaggcctctgggcagcccagccttcagagccagtggcagccccagctgcagcagctacgtgacatgggcatccaggacgatgagctgagcctgcgggccctgcaggccaccggtggggacatccaagcagccctggagctcatctttgctggaggagccccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - diacylglycerol O-acyltransferase homolog 2 (mouse) - TBC1 domain family, member 9B (with GRAM domain) - prolyl-tRNA synthetase 2, mitochondrial (putative) - cAMP responsive element binding protein 3-like 1 |