PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene View larger

PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene

PTXBC007956

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007956
Product type: DNA & cDNA
Ncbi symbol: PARS2
Origin species: Human
Product name: PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene
Size: 2ug
Accessions: BC007956
Gene id: 25973
Gene description: prolyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: MT-PRORS; proRS; proline tRNA ligase 2, mitochondrial (putative); prolyl-tRNA synthetase 2, mitochondrial (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagggctgctgacaagatgcagagcattgcccgccctggccacctgcagccgccagctctctgggtatgttccttgcaggtttcaccactgtgccccaagaagagggcggcgcctgctgctgtctcgtgtgttccagccacagaaccttcgggaagaccgggtgctctccctgcaggacaaatctgatgacctgacctgtaagagccagcggctgatgctgcaggtgggcctgatctacccagcaagccccggctgttaccacctcctgccatataccgtccgtgccatggagaagctcgtgcgagtgatagaccaggagatgcaggccatcgggggccagaaagtcaacatgcccagcctcagcccggcagagctctggcaagccaccaaccggtgggacttgatgggcaaagagctgctaagacttagagacaggcatggcaaggaatactgcttaggaccaactcacgaggaagccattacggccttaattgcctcccagaagaaactgtcctacaagcagcttcccttcctgctgtaccaagtgacaaggaagtttcgggatgagcccaggccccgctttggtcttctccgtggccgagagttttacatgaaggatatgtacacctttgactcctccccagaggctgcccagcagacctacagcctggtgtgtgatgcctactgcagcctgttcaacaagctagggctgccatttgtcaaggtccaggccgatgtgggcaccatcgggggcacagtgtctcatgagttccagctcccagtggatattggagaggaccggcttgccatctgtccccgctgcagcttctcagccaacatggagacactagacttgtcacaaatgaactgccctgcttgccagggcccattgactaaaaccaaaggcattgaggtggggcacacattttacctgggtaccaagtactcatccattttcaatgcccagtttaccaatgtctgtggcaaaccaaccctggctgaaatggggtgctatggcttgggtgtgacacggatcttggctgctgccattgaagtcctctctacagaagactgtgtccgctggcccagcctactggccccttaccaagcctgcctcatcccccctaagaagggcagtaaggagcaggcggcctccgagctcatagggcagctgtacgaccacatcacagaggcagtgcctcagcttcacggggaggtgctcctggacgacaggacccatctgaccatcggaaacagactgaaagatgccaacaagtttggctacccctttgtgataatcgctggcaagagggccctggaggaccctgcacattttgaggtttggtgtcagaacactggtgaggtggccttcctcaccaaagatggagtcatggatttactgaccccagtgcagactgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cAMP responsive element binding protein 3-like 1
- FAD-dependent oxidoreductase domain containing 2
- ATG2 autophagy related 2 homolog B (S. cerevisiae)
- origin recognition complex, subunit 1-like (yeast)

Buy PARS2-prolyl-tRNA synthetase 2, mitochondrial (putative) Gene now

Add to cart