TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene View larger

TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene

PTXBC000701

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000701
Product type: DNA & cDNA
Ncbi symbol: TBC1D9B
Origin species: Human
Product name: TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene
Size: 2ug
Accessions: BC000701
Gene id: 23061
Gene description: TBC1 domain family, member 9B (with GRAM domain)
Synonyms: GRAMD9B; TBC1 domain family member 9B; TBC1 domain family, member 9B (with GRAM domain)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggccgtcgggaccccagcctgccctacctggagcagtaccggattgatgccagccagttccgggaactctttgccagcctgacaccctgggcctgtggctcccacacacctctgctggcagggcgcatgttcaggctcctggacgaaaacaaggactcgctgatcaacttcaaggagttcgtgacagggatgagcgggatgtaccacgggtacctgacagagaagctcaaggtgctctacaagctacaccttcccccagctctgagcccagaggaagccgagtcagccctggaggcggcccattatttcacagaggacagctcctcagaagaagcactaccacaggaagagcaagaaggaagtggaagtgaggagagaggagaggagaaggggaccagctctccggactatcggcactaccttcgaatgtgggccaaggagaaagaggctcagaaggagacgattaaggatcttcccaagatgaaccaggagcagttcattgagctgtgcaagacgctttacaacatgttcagtgaagaccccatggagcaggacctgtaccacgccatcgccaccgtggccagcctcctgctccgcatcggagaggtggggaagaagttctcagcccgcacaggcaggaagcccagggactgtgccactgaggaggacgagccaccagcacccgaactgcatcaggacgcagccagggagcttcagcccccagctgcaggagacccccaagccaaagcaggcggagacacacacctcggaacagccccacaggagagccaggtggtggtggaggggggcagcggcgagggacagggctcaccctcccagctgctgtctgacgatgaaaccaaagacgacatgtccatgtcctcctactcggtggtcagcacgggctccctgcaatgtgaagaccttgcagacgacacggtgctggtgggcggggaggcctgcagccccacagcgcgcatcggcggcaccgtcgacaccgactggtgcatctcctttgagcagatcctggcctccatcctgacggagtccgtgctggtgaacttctttgagaagagagtggacattggactcaagatcaaggaccaaaagaaagtggagagacagttcagcaccgccagtgaccatgagcagcctggagtttccggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolyl-tRNA synthetase 2, mitochondrial (putative)
- cAMP responsive element binding protein 3-like 1
- FAD-dependent oxidoreductase domain containing 2
- ATG2 autophagy related 2 homolog B (S. cerevisiae)

Buy TBC1D9B-TBC1 domain family, member 9B (with GRAM domain) Gene now

Add to cart