Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene
PTXBC015234
New product
Data sheet of DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015234 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DGAT2 |
| Origin species: | Human |
| Product name: | DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC015234 |
| Gene id: | 84649 |
| Gene description: | diacylglycerol O-acyltransferase homolog 2 (mouse) |
| Synonyms: | ARAT; GS1999FULL; HMFN1045; diacylglycerol O-acyltransferase 2; acyl-CoA retinol O-fatty-acyltransferase; diacylglycerol O-acyltransferase homolog 2; diacylglycerol O-acyltransferase-like protein 2; diglyceride acyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaccctcatagccgcctactccggggtcctgcgcggcgagcgtcaggccgaggctgaccggagccagcgctctcacggaggacctgcgctgtcgcgcgaggggtctgggagatggggcactggatccagcatcctctccgccctccaggacctcttctctgtcacctggctcaataggtccaaggtggaaaagcagctacaggtcatctcagtgctccagtgggtcctgtccttccttgtactgggagtggcctgcagtgccatcctcatgtacatattctgcactgattgctggctcatcgctgtgctctacttcacttggctggtgtttgactggaacacacccaagaaaggtggcaggaggtcacagtgggtccgaaactgggctgtgtggcgctactttcgagactactttcccatccagctggtgaagacacacaacctgctgaccaccaggaactatatctttggataccacccccatggtatcatgggcctgggtgccttctgcaacttcagcacagaggccacagaagtgagcaagaagttcccaggcatacggccttacctggctacactggcaggcaacttccgaatgcctgtgttgagggagtacctgatgtctggaggtatctgccctgtcagccgggacaccatagactatttgctttcaaagaatgggagtggcaatgctatcatcatcgtggtcgggggtgcggctgagtctctgagctccatgcctggcaagaatgcagtcaccctgcggaaccgcaagggctttgtgaaactggccctgcgtcatggagctgacctggttcccatctactcctttggagagaatgaagtgtacaagcaggtgatcttcgaggagggctcctggggccgatgggtccagaagaagttccagaaatacattggtttcgccccatgcatcttccatggtcgaggcctcttctcctccgacacctgggggctggtgccctactccaagcccatcaccactgttgtgggagagcccatcaccatccccaagctggagcacccaacccagcaagacatcgacctgtaccacaccatgtacatggaggccctggtgaagctcttcgacaagcacaagaccaagttcggcctcccggagactgaggtcctggaggtgaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TBC1 domain family, member 9B (with GRAM domain) - prolyl-tRNA synthetase 2, mitochondrial (putative) - cAMP responsive element binding protein 3-like 1 - FAD-dependent oxidoreductase domain containing 2 |