DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene View larger

DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene

PTXBC015234

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015234
Product type: DNA & cDNA
Ncbi symbol: DGAT2
Origin species: Human
Product name: DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene
Size: 2ug
Accessions: BC015234
Gene id: 84649
Gene description: diacylglycerol O-acyltransferase homolog 2 (mouse)
Synonyms: ARAT; GS1999FULL; HMFN1045; diacylglycerol O-acyltransferase 2; acyl-CoA retinol O-fatty-acyltransferase; diacylglycerol O-acyltransferase homolog 2; diacylglycerol O-acyltransferase-like protein 2; diglyceride acyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaccctcatagccgcctactccggggtcctgcgcggcgagcgtcaggccgaggctgaccggagccagcgctctcacggaggacctgcgctgtcgcgcgaggggtctgggagatggggcactggatccagcatcctctccgccctccaggacctcttctctgtcacctggctcaataggtccaaggtggaaaagcagctacaggtcatctcagtgctccagtgggtcctgtccttccttgtactgggagtggcctgcagtgccatcctcatgtacatattctgcactgattgctggctcatcgctgtgctctacttcacttggctggtgtttgactggaacacacccaagaaaggtggcaggaggtcacagtgggtccgaaactgggctgtgtggcgctactttcgagactactttcccatccagctggtgaagacacacaacctgctgaccaccaggaactatatctttggataccacccccatggtatcatgggcctgggtgccttctgcaacttcagcacagaggccacagaagtgagcaagaagttcccaggcatacggccttacctggctacactggcaggcaacttccgaatgcctgtgttgagggagtacctgatgtctggaggtatctgccctgtcagccgggacaccatagactatttgctttcaaagaatgggagtggcaatgctatcatcatcgtggtcgggggtgcggctgagtctctgagctccatgcctggcaagaatgcagtcaccctgcggaaccgcaagggctttgtgaaactggccctgcgtcatggagctgacctggttcccatctactcctttggagagaatgaagtgtacaagcaggtgatcttcgaggagggctcctggggccgatgggtccagaagaagttccagaaatacattggtttcgccccatgcatcttccatggtcgaggcctcttctcctccgacacctgggggctggtgccctactccaagcccatcaccactgttgtgggagagcccatcaccatccccaagctggagcacccaacccagcaagacatcgacctgtaccacaccatgtacatggaggccctggtgaagctcttcgacaagcacaagaccaagttcggcctcccggagactgaggtcctggaggtgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TBC1 domain family, member 9B (with GRAM domain)
- prolyl-tRNA synthetase 2, mitochondrial (putative)
- cAMP responsive element binding protein 3-like 1
- FAD-dependent oxidoreductase domain containing 2

Buy DGAT2-diacylglycerol O-acyltransferase homolog 2 (mouse) Gene now

Add to cart