GEM-GTP binding protein overexpressed in skeletal muscle Gene View larger

GEM-GTP binding protein overexpressed in skeletal muscle Gene

PTXBC022010

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GEM-GTP binding protein overexpressed in skeletal muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GEM-GTP binding protein overexpressed in skeletal muscle Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022010
Product type: DNA & cDNA
Ncbi symbol: GEM
Origin species: Human
Product name: GEM-GTP binding protein overexpressed in skeletal muscle Gene
Size: 2ug
Accessions: BC022010
Gene id: 2669
Gene description: GTP binding protein overexpressed in skeletal muscle
Synonyms: GTP-binding protein GEM; KIR; GTP-binding mitogen-induced T-cell protein; RAS-like protein KIR; kinase-inducible Ras-like protein; GTP binding protein overexpressed in skeletal muscle
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactctgaataatgtcaccatgcgccagggcactgtgggcatgcagccacagcagcagcgctggagcatcccagctgatggcaggcatctgatggtccagaaagagccccaccagtacagccaccgcaaccgccattctgctacccctgaggaccactgccgccgaagctggtcctctgactccacagactcagtcatctcctctgagtcagggaacacctactaccgagtggtgctcataggggagcagggggtgggcaagtccactctggccaacatctttgcaggtgtgcatgacagcatggacagcgactgcgaggtgctgggagaagatacatatgaacgaaccctgatggttgatggggaaagtgcaacgattatactcctggatatgtgggaaaataagggggaaaatgaatggctccatgaccactgcatgcaggtcggggacgcatacctgattgtctactcaatcacagaccgagcgagcttcgagaaggcatctgagctgcgaatccagctccgcagggcccggcagacagaggacattcccataattttggttggcaacaaaagtgacttagtgcggtgccgagaagtgtctgtatcagaagggagagcctgtgcagtggtgtttgactgcaagttcatcgagacctctgcagctgtccagcacaacgtgaaggagctgtttgagggcattgtgcgacaggtgcgccttcggcgggacagcaaggagaagaatgaacggcggctggcctaccagaaaaggaaggagagcatgcccaggaaagccaggcgcttctggggcaagatcgtggccaaaaacaacaagaatatggccttcaagctcaagtccaaatcctgccatgacctctctgtactctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - activating signal cointegrator 1 complex subunit 1
- ubiquitin-like 7 (bone marrow stromal cell-derived)
- diacylglycerol O-acyltransferase homolog 2 (mouse)
- TBC1 domain family, member 9B (with GRAM domain)

Buy GEM-GTP binding protein overexpressed in skeletal muscle Gene now

Add to cart