Login to display prices
Login to display prices
GEM-GTP binding protein overexpressed in skeletal muscle Gene View larger

GEM-GTP binding protein overexpressed in skeletal muscle Gene

PTXBC022010

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GEM-GTP binding protein overexpressed in skeletal muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GEM-GTP binding protein overexpressed in skeletal muscle Gene

Proteogenix catalog: PTXBC022010
Ncbi symbol: GEM
Product name: GEM-GTP binding protein overexpressed in skeletal muscle Gene
Size: 2ug
Accessions: BC022010
Gene id: 2669
Gene description: GTP binding protein overexpressed in skeletal muscle
Synonyms: GTP-binding protein GEM; KIR; GTP-binding mitogen-induced T-cell protein; RAS-like protein KIR; kinase-inducible Ras-like protein; GTP binding protein overexpressed in skeletal muscle
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactctgaataatgtcaccatgcgccagggcactgtgggcatgcagccacagcagcagcgctggagcatcccagctgatggcaggcatctgatggtccagaaagagccccaccagtacagccaccgcaaccgccattctgctacccctgaggaccactgccgccgaagctggtcctctgactccacagactcagtcatctcctctgagtcagggaacacctactaccgagtggtgctcataggggagcagggggtgggcaagtccactctggccaacatctttgcaggtgtgcatgacagcatggacagcgactgcgaggtgctgggagaagatacatatgaacgaaccctgatggttgatggggaaagtgcaacgattatactcctggatatgtgggaaaataagggggaaaatgaatggctccatgaccactgcatgcaggtcggggacgcatacctgattgtctactcaatcacagaccgagcgagcttcgagaaggcatctgagctgcgaatccagctccgcagggcccggcagacagaggacattcccataattttggttggcaacaaaagtgacttagtgcggtgccgagaagtgtctgtatcagaagggagagcctgtgcagtggtgtttgactgcaagttcatcgagacctctgcagctgtccagcacaacgtgaaggagctgtttgagggcattgtgcgacaggtgcgccttcggcgggacagcaaggagaagaatgaacggcggctggcctaccagaaaaggaaggagagcatgcccaggaaagccaggcgcttctggggcaagatcgtggccaaaaacaacaagaatatggccttcaagctcaagtccaaatcctgccatgacctctctgtactctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: