ASCC1-activating signal cointegrator 1 complex subunit 1 Gene View larger

ASCC1-activating signal cointegrator 1 complex subunit 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASCC1-activating signal cointegrator 1 complex subunit 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ASCC1-activating signal cointegrator 1 complex subunit 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012291
Product type: DNA & cDNA
Ncbi symbol: ASCC1
Origin species: Human
Product name: ASCC1-activating signal cointegrator 1 complex subunit 1 Gene
Size: 2ug
Accessions: BC012291
Gene id: 51008
Gene description: activating signal cointegrator 1 complex subunit 1
Synonyms: ASC1p50; CGI-18; SMABF2; p50; activating signal cointegrator 1 complex subunit 1; ASC-1 complex subunit P50; trip4 complex subunit p50
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagttctgcgtccacagcttataagaattgatggccggaattacaggaagaatccagtccaagaacagacctatcaacatgaagaagatgaagaggacttctatcaaggctccatggagtgtgctgatgagccctgtgatgcctacgaggtggagcagaccccacaaggattccggtctactttgagggcccccagcttgctctataagcatatagttggaaagagaggggacactaggaagaaaatagaaatggagaccaaaacttctattagcattcctaaacctggacaagacggggaaattgtaatcactggccagcatcgaaatggtgtaatttcagcccgaacacggattgatgttcttttggacacttttcgaagaaagcagcccttcactcacttccttgcctttttcctcaatgaagttgaggttcaggaaggattcctgagattccaggaggaagtactggcgaagtgctccatggatcatggggttgacagcagcattttccagaatcctaaaaagcttcatctaactattgggatgttggtgcttttgagtgaggaagagatccagcagacatgtgagatgctacagcagtgtaaagaggaattcattaatgatatttctgggggtaaacccctagaagtggagatggcagggatagaatacatgaatgatgatcctggcatggtggatgttctttacgccaaagtccatatgaaagatggctccaacaggctacaagaattagttgatcgagtgctggaacgttttcaggcatctggactaatagtgaaagagtggaatagtgtgaaactgcatgctacagttatgaatacactattcaggaaagaccccaatgctgaaggcaggtacaatctctacacagcggaaggcaaatatatcttcaaggaaagagaatcatttgatggccgaaatattttaaagttgtttgagaacttctactttggctccctaaagctgaattcaattcacatctctcagaggttcaccgtagacagctttggaaactacgcttcctgtggacaaattgacttctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-like 7 (bone marrow stromal cell-derived)
- diacylglycerol O-acyltransferase homolog 2 (mouse)
- TBC1 domain family, member 9B (with GRAM domain)
- prolyl-tRNA synthetase 2, mitochondrial (putative)

Buy ASCC1-activating signal cointegrator 1 complex subunit 1 Gene now

Add to cart