OLA1-Obg-like ATPase 1 Gene View larger

OLA1-Obg-like ATPase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OLA1-Obg-like ATPase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OLA1-Obg-like ATPase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013925
Product type: DNA & cDNA
Ncbi symbol: OLA1
Origin species: Human
Product name: OLA1-Obg-like ATPase 1 Gene
Size: 2ug
Accessions: BC013925
Gene id: 29789
Gene description: Obg-like ATPase 1
Synonyms: DOC45; GBP45; GTBP9; GTPBP9; PTD004; obg-like ATPase 1; DNA damage-regulated overexpressed in cancer 45 protein; GTP-binding protein 9 (putative); GTP-binding protein PTD004; homologous yeast-44.2 protein; Obg like ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccctaaaaagggaggtgatggaattaaaccacccccaatcattggaagatttggaacctcactgaaaattggtattgttggattgccaaatgttgggaaatctactttcttcaatgtgttaaccaatagtcaggcttcagcagaaaacttcccgttctgcactattgatcctaatgagagcagagtacctgtgccagatgaaaggtttgactttctttgtcaataccacaaaccagcaagcaaaattcctgcctttctaaatgtggtggatattgctggccttgtgaaaggagctcacaatgggcagggcctggggaatgcttttttatctcatattagtgcctgtgatggcatctttcatctaacacgtgcttttgaagatgatgatatcacgcacgttgaaggaagtgtagatcctattcgagatatagaaataatacatgaagagcttcagcttaaagatgaggaaatgattgggcccattatagataaactagaaaaggtggctgtgagaggaggagataaaaaactaaaacctgaatatgatataatgtgcaaagtaaaatcctgggttatagatcaaaagaaacctgttcgcttctatcatgattggaatgacaaagagattgaagtgttgaataaacacttatttttgacttcaaaaccaatggtctacttggttaatctttctgaaaaagactacattagaaagaaaaacaaatggctgctggaaagtacagacaacaaggcagaaattatattgttgaagatggagatattatcttcttcaaatttaacacacctcaacaaccgaagaagaaataaaatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD300a molecule
- tetraspanin 16
- arginase, type II
- tubulin, delta 1

Buy OLA1-Obg-like ATPase 1 Gene now

Add to cart