Login to display prices
Login to display prices
TSPAN16-tetraspanin 16 Gene View larger

TSPAN16-tetraspanin 16 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN16-tetraspanin 16 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN16-tetraspanin 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029908
Product type: DNA & cDNA
Ncbi symbol: TSPAN16
Origin species: Human
Product name: TSPAN16-tetraspanin 16 Gene
Size: 2ug
Accessions: BC029908
Gene id: 26526
Gene description: tetraspanin 16
Synonyms: TM-8; TM4-B; TM4SF16; tetraspanin-16; tetraspanin TM4-B; transmembrane 4 superfamily member 16; tspan-16; tetraspanin 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaaatccacactccgtattcttccttgaagaaactgttatctttactcaatggcttcgtggctgtgtctggcatcatcctagttggcctgggcattggtggtaaatgtggaggggcctctctgacgaatgtcctcgggctgtcctccgcatacctccttcacgttggcaacctgtgcctggtgatgggatgcatcacggtactgcttggctgtgccgggtggtatggagcgactaaagagagcagaggcacgctcttgttttgcatcctgtcaatggttattgtcctcatcatggaagttacagctgccacagtggtccttcttttctttccaattgttggagatgtggccttggaacacaccttcgtgaccctgaggaagaattacagaggttacaacgagccagacgactattctacacagtggaacttggtcatggagaagggactctccaagtatttcttctcctctctatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arginase, type II
- tubulin, delta 1
- adducin 1 (alpha)
- dynactin 2 (p50)