Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD300A-CD300a molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD300A-CD300a molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD300A |
| Origin species: | Human |
| Product name: | CD300A-CD300a molecule Gene |
| Size: | 2ug |
| Accessions: | BC032352 |
| Gene id: | 11314 |
| Gene description: | CD300a molecule |
| Synonyms: | CD300a molecule; CD300a antigen; CLM-8; CMRF-35-H9; CMRF-35H; CMRF35-H; CMRF35-H9; CMRF35H; CMRF35H9; IGSF12; IRC1; IRC1/IRC2; IRC2; IRp60; CMRF35-like molecule 8; CD300 antigen-like family member A; CMRF35H leukocyte immunoglobulin-like receptor; NK inhibitory receptor; immunoglobulin superfamily member 12; inhibitory receptor protein 60; leukocyte membrane antigen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctgccttgggctctgttgcttctctgggtcccaggatgttttgctctgagcaaatgcaggaccgtggcgggccccgtggggggatccctgagtgtgcagtgtccctatgagaaggaacacaggaccctcaacaaatactggtgcagaccaccacagattttcctatgtgacaagattgtggagaccaaagggtcagcaggaaaaaggaacggccgagtgtccatcagggacagtcctgcaaacctcagcttcacagtgaccctggagaatctcacagaggaggatgcaggcacctactggtgtggggtggatacaccatggctccgagactttcatgatcccgttgtcgaggttgaggtgtccgtgttcccggcatcaacgtcaatgacacctgcaagtatcactgcggccaagacctcaacaatcacaactgcatttccacctgtatcatccactaccctgtttgcagtgggtgccacccacagtgccagcatccaggaggaaactgaggaggtggtgaactcacagctcccgctgctcctctccctgctggcattgttgctgcttctgttggtgggggcctccctgctagcctggaggatgtttcagaaatggatcaaagctggtgaccattcagagctgtcccagaaccccaagcaggctgccacgcagagtgagctgcactacgcaaatctggagctgctgatgtggcctctgcaggaaaagccagcaccaccaagggaggtggaggtggaatacagcactgtggcctcccccagggaagaacttcactatgcctcggtggtgtttgattctaacaccaacaggatagctgctcagaggcctcgggaggaggaaccagattcagattacagtgtgataaggaagacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetraspanin 16 - arginase, type II - tubulin, delta 1 - adducin 1 (alpha) |