Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC10A6-solute carrier family 10 (sodium/bile acid cotransporter family), member 6 Gene
PTXBC107051
New product
Data sheet of SLC10A6-solute carrier family 10 (sodium/bile acid cotransporter family), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC10A6-solute carrier family 10 (sodium/bile acid cotransporter family), member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107051 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC10A6 |
| Origin species: | Human |
| Product name: | SLC10A6-solute carrier family 10 (sodium/bile acid cotransporter family), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC107051 |
| Gene id: | 345274 |
| Gene description: | solute carrier family 10 (sodium/bile acid cotransporter family), member 6 |
| Synonyms: | SOAT; solute carrier family 10 member 6; sodium-dependent organic anion transporter; solute carrier family 10 (sodium/bile acid cotransporter family), member 6; solute carrier family 10 (sodium/bile acid cotransporter), member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagccaattgttccagcagctcagcctgccctgccaacagttcagaggaggagctgccagtgggactggaggtgcatggaaacctggagctcgttttcacagtggtgtccactgtgatgatggggctgctcatgttctctttgggatgttccgtggagatccggaagctgtggtcgcacatcaggagaccctggggcattgctgtgggactgctctgccagtttgggctcatgccttttacagcttatctcctggccattagcttttctctgaagccagtccaagctattgctgttctcatcatgggctgctgcccggggggcaccatctctaacgttttcaccttctgggttgatggagatatggatctcagcatcagtatgacaacctgttccaccgtggccgccctgggaatgatgccactctgcatttatctctacacctggtcctggagtcttcagcagaatctcaccattccttatcagaacataggaattacccttgtgtgcctgaccattcctgtggcctttggtgtctatgtgaattacagatggccaaaacaatccaaaatcattctcaagattggggccgttgttggtggggtcctccttctggtggtcgcagttgctggtgtggtcctggcgaaaggatcttggaattcagacatcacccttctgaccatcagtttcatctttcctttgattggccatgtcacgggttttctgctggcactttttacccaccagtcttggcaaaggtgcaggacaatttccttagaaactggagctcagaatattcagatgtgcatcaccatgctccagttatctttcactgctgagcacttggtccagatgttgagtttcccactggcctatggactcttccagctgatagatggatttcttattgttgcagcatatcagacgtacaagaggagattgaagaacaaacatggaaaaaagaactcaggttgcacagaagtctgccatacgaggaaatcgacttcttccagagagaccaatgccttcttggaggtgaatgaagaaggtgccatcactcctgggccaccagggccaatggattgccacagggctctcgagccagttggccacatcacttcatgtgaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 - serine palmitoyltransferase, long chain base subunit 1 - unconventional SNARE in the ER 1 homolog (S. cerevisiae) - NK2 transcription factor related, locus 5 (Drosophila) |