Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene
PTXBC006005
New product
Data sheet of USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006005 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | USE1 |
| Origin species: | Human |
| Product name: | USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC006005 |
| Gene id: | 55850 |
| Gene description: | unconventional SNARE in the ER 1 homolog (S. cerevisiae) |
| Synonyms: | USE1-like protein; vesicle transport protein USE1; D12; MDS032; P31; SLT1; Q-SNARE; SNARE-like tail-anchored protein 1 homolog; protein p31; unconventional SNARE in the ER 1 homolog; unconventional SNARE in the ER 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgtcgaggctggagctaaacctggtgcggctgctatcccgctgcgaggcgatggcagcggagaaacgggacccggacgagtggcgcctggagaagtacgtgggagtcctagaggacatgttgcaggccctgaaggtccacgcgagcaaaccggcctctgaggtgatcaatgaatattcctggaaggtggattttctgaaggggatgctgcaagccgagaagctgacctcctcctcagagaaagcactggccaaccagttcctggcccctggccgtgtgccaaccacagccagagagcgagtgcccgccacaaagacggtgcatctgcagtcacgggcgcggtacaccagcgagatgcggagtgagctactaggcacggactctgcagagcctgagatggacgtaaggaagagaacaccctgtcacactcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NK2 transcription factor related, locus 5 (Drosophila) - general transcription factor IIH, polypeptide 2, 44kDa - PMS1 postmeiotic segregation increased 1 (S. cerevisiae) - MOB1, Mps One Binder kinase activator-like 1A (yeast) |