USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene View larger

USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene

PTXBC006005

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006005
Product type: DNA & cDNA
Ncbi symbol: USE1
Origin species: Human
Product name: USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006005
Gene id: 55850
Gene description: unconventional SNARE in the ER 1 homolog (S. cerevisiae)
Synonyms: USE1-like protein; vesicle transport protein USE1; D12; MDS032; P31; SLT1; Q-SNARE; SNARE-like tail-anchored protein 1 homolog; protein p31; unconventional SNARE in the ER 1 homolog; unconventional SNARE in the ER 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgtcgaggctggagctaaacctggtgcggctgctatcccgctgcgaggcgatggcagcggagaaacgggacccggacgagtggcgcctggagaagtacgtgggagtcctagaggacatgttgcaggccctgaaggtccacgcgagcaaaccggcctctgaggtgatcaatgaatattcctggaaggtggattttctgaaggggatgctgcaagccgagaagctgacctcctcctcagagaaagcactggccaaccagttcctggcccctggccgtgtgccaaccacagccagagagcgagtgcccgccacaaagacggtgcatctgcagtcacgggcgcggtacaccagcgagatgcggagtgagctactaggcacggactctgcagagcctgagatggacgtaaggaagagaacaccctgtcacactcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NK2 transcription factor related, locus 5 (Drosophila)
- general transcription factor IIH, polypeptide 2, 44kDa
- PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
- MOB1, Mps One Binder kinase activator-like 1A (yeast)

Buy USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene now

Add to cart