No products
Prices are tax excluded
PTXBC006005
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006005 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | USE1 |
| Origin species: | Human |
| Product name: | USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC006005 |
| Gene id: | 55850 |
| Gene description: | unconventional SNARE in the ER 1 homolog (S. cerevisiae) |
| Synonyms: | USE1-like protein; vesicle transport protein USE1; D12; MDS032; P31; SLT1; Q-SNARE; SNARE-like tail-anchored protein 1 homolog; protein p31; unconventional SNARE in the ER 1 homolog; unconventional SNARE in the ER 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgtcgaggctggagctaaacctggtgcggctgctatcccgctgcgaggcgatggcagcggagaaacgggacccggacgagtggcgcctggagaagtacgtgggagtcctagaggacatgttgcaggccctgaaggtccacgcgagcaaaccggcctctgaggtgatcaatgaatattcctggaaggtggattttctgaaggggatgctgcaagccgagaagctgacctcctcctcagagaaagcactggccaaccagttcctggcccctggccgtgtgccaaccacagccagagagcgagtgcccgccacaaagacggtgcatctgcagtcacgggcgcggtacaccagcgagatgcggagtgagctactaggcacggactctgcagagcctgagatggacgtaaggaagagaacaccctgtcacactcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - NK2 transcription factor related, locus 5 (Drosophila) - general transcription factor IIH, polypeptide 2, 44kDa - PMS1 postmeiotic segregation increased 1 (S. cerevisiae) - MOB1, Mps One Binder kinase activator-like 1A (yeast) |