Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NKX2-5-NK2 transcription factor related, locus 5 (Drosophila) Gene
PTXBC025711
New product
Data sheet of NKX2-5-NK2 transcription factor related, locus 5 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NKX2-5-NK2 transcription factor related, locus 5 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NKX2-5 |
| Origin species: | Human |
| Product name: | NKX2-5-NK2 transcription factor related, locus 5 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC025711 |
| Gene id: | 1482 |
| Gene description: | NK2 transcription factor related, locus 5 (Drosophila) |
| Synonyms: | CHNG5; CSX; CSX1; HLHS2; NKX2.5; NKX2E; NKX4-1; VSD3; homeobox protein Nkx-2.5; NK2 transcription factor related, locus 5; NKX 2-5; cardiac-specific homeobox 1; homeobox protein CSX; homeobox protein NK-2 homolog E; homeobox protein NKX 2-5; tinman paralog; NK2 homeobox 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccccagccctgctctcacgcccacgcccttctcagtcaaagacatcctaaacctggaacagcagcagcgcagcctggctgccgccggagagctctctgcccgcctggaggcgaccctggcgccctcctcctgcatgctggccgccttcaagccagaggcctacgctgggcccgaggcggctgcgccgggcctcccagagctgcgcgcagagctgggccgcgcgccttcaccggccaagtgtgcgtctgcctttcccgccgcccccgccttctatccacgtgcctacagcgaccccgacccagccaaggaccctagagccgaaaagaaagagctgtgcgcgctgcagaaggcggtggagctggagaagacagaggcggacaacgcggagcggccccgggcgcgacggcggaggaagccgcgcgtgctcttctcgcaggcgcaggtctatgagctggagcggcgcttcaagcagcagcggtacctgtcggcccccgaacgcgaccagctggccagcgtgctgaaactcacgtccacgcaggtcaagatctggttccagaaccggcgctacaagtgcaagcggcagcggcaggaccagactctggagctggtggggctgcccccgccgccgccgccgcctgcccgcaggatcgcggtgccagtgctggtgcgcgatggcaagccatgcctaggggactcggcgccctacgcgcctgcctacggcgtgggcctcaatccctacggttataacgcctaccccgcctatccgggttacggcggcgcggcctgcagccctggctacagctgcactgccgcttaccccgccgggccttccccagcgcagccggccactgccgccgccaacaacaacttcgtgaacttcggcgtcggggacttgaatgcggttcagagccccgggattccgcagagcaactcgggagtgtccacgctgcatggtatccgagcctggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIH, polypeptide 2, 44kDa - PMS1 postmeiotic segregation increased 1 (S. cerevisiae) - MOB1, Mps One Binder kinase activator-like 1A (yeast) - MOB1, Mps One Binder kinase activator-like 2C (yeast) |