MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene View larger

MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026078
Product type: DNA & cDNA
Ncbi symbol: MOBKL2C
Origin species: Human
Product name: MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene
Size: 2ug
Accessions: BC026078
Gene id: 148932
Gene description: MOB1, Mps One Binder kinase activator-like 2C (yeast)
Synonyms: MOBKL2C; MOB1E; MOB kinase activator 3C; MOB1, Mps One Binder kinase activator-like 2C; mob1 homolog 2C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgtgcctgaagcaggtgttcgccaaggacaagacgttccggccgcggaagcgctttgagccgggcacacagcgctttgagctgtacaagaaggcacaggcctctctcaagtcgggcctggacctgcgcagtgtggtgaggctaccacccggggagaacatcgacgactggatcgccgtgcacgtggtggacttcttcaaccgcatcaacctcatctacggcactatggcggagcgctgcagtgagaccagctgcccggtcatggccggcgggccccgctacgagtaccgctggcaggacgagcgccagtaccggcggcccgccaagctctctgcgccgcgctatatggcgttgctcatggactggatcgaaggcctcatcaacgacgaagaggtctttcccacgcgtgttggagttcccttccctaagaacttccagcaggtctgcaccaagatcctgacccgcctcttccgagtctttgtccatgtctacatccaccacttcgatagcatcctcagcatgggggcagaggagcacgtcaacacctgctacaagcacttctactacttcatccgcgagttcagtctggtggaccagcgggagctggagccactgagggagatgacagagcggatctgccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MOB1, Mps One Binder kinase activator-like 2A (yeast)
- unconventional SNARE in the ER 1 homolog (S. cerevisiae)
- phosphatidylinositol glycan anchor biosynthesis, class C
- potassium channel tetramerisation domain containing 17

Buy MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene now

Add to cart